View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2740_low_29 (Length: 223)
Name: NF2740_low_29
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2740_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 2873609 - 2873799
Alignment:
| Q |
15 |
aatatgattatgattatgggtgaaaattgatgtccatacatgcaatggaacacccttttaatttggggattaatttaacataacttgcataatttannnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2873609 |
aatatgattatgattatgggtgaaaattgatgtccatacatgcaatggaacacccttttaatttggggattaatttaacataacttgcataatttatttt |
2873708 |
T |
 |
| Q |
115 |
nnnnnnnnnngtgatgcatagatttgctatctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtcta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2873709 |
ttatttttttgtgatgcatagatttgctatctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtcta |
2873799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 144 - 204
Target Start/End: Complemental strand, 2901455 - 2901395
Alignment:
| Q |
144 |
tctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtct |
204 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
2901455 |
tctgagttgtctagaagagaaaaggaagcaaagattaagccagacccagatattgatgtct |
2901395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University