View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2740_low_8 (Length: 307)
Name: NF2740_low_8
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2740_low_8 |
 | |
|
| [»] scaffold0449 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0449 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 4041 - 3734
Alignment:
| Q |
1 |
ctgcgtcgtcatttgtatgttacattctctcaatcatcctcaagaaaaccctaatgctctgcccaacctgaaccagctgccgcgcgataactttgatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
4041 |
ctgcgtcgtcatttgtatgttacattctctcaatcatcctcaagaaaaccctaatgctctgcccaacctggaccagccgccgcgccataactttgatatg |
3942 |
T |
|
| Q |
101 |
tgattttctatttttctttggatggtgcttttacgcgctgctcatgctccaatatgtcattcctctcaaagatcttggcctctccactttcactataact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3941 |
tgattttctatttttctttggatggtgcttttacgcgctgctcatgctccaatatgtcattcctctcaaagatcttggcctctccactttcactacaact |
3842 |
T |
|
| Q |
201 |
atactctatctactctctactgttgttgctgccccc-tttgatgtatgtggctagcatgcatcttgtttatttactcagtatcattgttattttcattta |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3841 |
atactctatctactctctactgttgttgctgcccccttttgatgtatgtggctagcatgcaacttgtttatttacccagtatcattgttattttcattta |
3742 |
T |
|
| Q |
300 |
tatatgca |
307 |
Q |
| |
|
|||||||| |
|
|
| T |
3741 |
tatatgca |
3734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University