View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2742_high_26 (Length: 261)
Name: NF2742_high_26
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2742_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 43 - 203
Target Start/End: Complemental strand, 43769972 - 43769812
Alignment:
| Q |
43 |
taaaatgttagtttttacctacttgactcatgttgaatcaccatttgataacaagtagattgctcnnnnnnntattgatgaacattgaaaacataaaggg |
142 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43769972 |
taaaatgttggtttttacctacttgactcatgttgaatcaccatttgataacaagtagattgctcaaaaaaatattgatgaacattgaaaacataaaggg |
43769873 |
T |
 |
| Q |
143 |
tatggtattggtcatcaaattgacaagtctcccatctaaatcaacaaattgaagcataaat |
203 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
43769872 |
tatggtattggacatcaaattgacaagtctccaatctaaatcaactaattgaagcataaat |
43769812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 43769793 - 43769738
Alignment:
| Q |
196 |
gcataaatataatagaatggttataaggaaaataaaacaaagtaccttatgagtat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43769793 |
gcataaatataatagaatggttataaggaaaataaaacaaagtaccttaggagtat |
43769738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University