View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2742_high_26 (Length: 261)

Name: NF2742_high_26
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2742_high_26
NF2742_high_26
[»] chr3 (2 HSPs)
chr3 (43-203)||(43769812-43769972)
chr3 (196-251)||(43769738-43769793)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 43 - 203
Target Start/End: Complemental strand, 43769972 - 43769812
Alignment:
43 taaaatgttagtttttacctacttgactcatgttgaatcaccatttgataacaagtagattgctcnnnnnnntattgatgaacattgaaaacataaaggg 142  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
43769972 taaaatgttggtttttacctacttgactcatgttgaatcaccatttgataacaagtagattgctcaaaaaaatattgatgaacattgaaaacataaaggg 43769873  T
143 tatggtattggtcatcaaattgacaagtctcccatctaaatcaacaaattgaagcataaat 203  Q
    ||||||||||| |||||||||||||||||||| |||||||||||| |||||||||||||||    
43769872 tatggtattggacatcaaattgacaagtctccaatctaaatcaactaattgaagcataaat 43769812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 43769793 - 43769738
Alignment:
196 gcataaatataatagaatggttataaggaaaataaaacaaagtaccttatgagtat 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
43769793 gcataaatataatagaatggttataaggaaaataaaacaaagtaccttaggagtat 43769738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University