View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2742_high_27 (Length: 250)

Name: NF2742_high_27
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2742_high_27
NF2742_high_27
[»] chr2 (1 HSPs)
chr2 (15-247)||(4302617-4302845)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 247
Target Start/End: Original strand, 4302617 - 4302845
Alignment:
15 acaattggcattattgattagaacggatagaatacgaaatcaagacgttgcttgagggtgggggaatgcttttatacgaagaaacaagtttggtattcta 114  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4302617 acaattggcattattgattagaacggatagaatatgaaatcaagacgttgcttgagggtgggggaatgcttttatacgaagaaacaagtttggtattcta 4302716  T
115 aattgttagaatttaaatgggatgaacaaactctcaatgtacctgaataacagaaagtgatatatatcatgtattaaaaaacataacaagagaaacccaa 214  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||| |||||||||||||||||    
4302717 aattgttagaatttaaatggtatgaacaaactctcaatgtacctgaataacagaaagtg----atatcatgtattaaaaaacgtaacaagagaaacccaa 4302812  T
215 gcacaaggtgtgtctagattcaataaatatttc 247  Q
    |||||||||||||||||||||||||||||||||    
4302813 gcacaaggtgtgtctagattcaataaatatttc 4302845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University