View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2742_high_27 (Length: 250)
Name: NF2742_high_27
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2742_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 247
Target Start/End: Original strand, 4302617 - 4302845
Alignment:
| Q |
15 |
acaattggcattattgattagaacggatagaatacgaaatcaagacgttgcttgagggtgggggaatgcttttatacgaagaaacaagtttggtattcta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4302617 |
acaattggcattattgattagaacggatagaatatgaaatcaagacgttgcttgagggtgggggaatgcttttatacgaagaaacaagtttggtattcta |
4302716 |
T |
|
| Q |
115 |
aattgttagaatttaaatgggatgaacaaactctcaatgtacctgaataacagaaagtgatatatatcatgtattaaaaaacataacaagagaaacccaa |
214 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4302717 |
aattgttagaatttaaatggtatgaacaaactctcaatgtacctgaataacagaaagtg----atatcatgtattaaaaaacgtaacaagagaaacccaa |
4302812 |
T |
|
| Q |
215 |
gcacaaggtgtgtctagattcaataaatatttc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4302813 |
gcacaaggtgtgtctagattcaataaatatttc |
4302845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University