View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2742_high_28 (Length: 248)
Name: NF2742_high_28
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2742_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 42636603 - 42636818
Alignment:
| Q |
20 |
atttctaagcaacttaatagtatatttgggttagccaataatctccaataacctataaaagtaattatttctatccgcactccatgattttcagtaacag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42636603 |
atttctaagcaacttaatagtatatttgggttagccaataatctccaataacctataaaagtaattatttctatccgcactccatgattttcagtaacag |
42636702 |
T |
 |
| Q |
120 |
tcttgcgcgacatgatgcgtcttaagcagtgacgagacactttcaactcttcacaattgcgtgacacgtggattgtagcacgcatcgtgcatgtactagt |
219 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42636703 |
tcttgcgcgatgtgatgcgtcttaagcagtgacgagacactttcaactcttcacaattgcatgacatgtggattgtagcacgcatcgtgcatgtactagt |
42636802 |
T |
 |
| Q |
220 |
agtggatccttttgat |
235 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42636803 |
agtggatccttttgat |
42636818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University