View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2742_low_19 (Length: 358)
Name: NF2742_low_19
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2742_low_19 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0093 (1 HSPs) |
 |  |  |
|
| [»] scaffold2007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (4 HSPs) |
 |  |  |
|
| [»] scaffold0504 (1 HSPs) |
 |  |  |
|
| [»] scaffold0096 (1 HSPs) |
 |  |  |
|
| [»] scaffold1213 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0418 (1 HSPs) |
 |  |  |
|
| [»] scaffold1207 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 36)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 38056362 - 38056122
Alignment:
| Q |
13 |
aagaatattgaagaattagcatggaaagaatattgaagagtggatgtggctgagaattacaaagtttcgacgaactaatggcttgaagattcgttcaaat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38056362 |
aagaatattgaagaattagcatggaaagaatattgaagagtggatgtggctgagaattacaaagtttcgacaaactaatggcttgaagattcgttcaaat |
38056263 |
T |
 |
| Q |
113 |
taagcttttagtgaatatgtgatcaaaatcaagtataatcgcgcagtgaaaacaaatgtgagttgatttagtaaacaattataagcttttgattttaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
38056262 |
taagcttttagtgaatatgtgatcaaaatcaagtataatcgcgcagtgaaaacagatgtgagttgatttagtaaacaattataagcctttgatttttaaa |
38056163 |
T |
 |
| Q |
213 |
aatagacagttgagatttggtatcaacgaatccgttgacac |
253 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38056162 |
aatagacggttgagatttggtatcaacgaatccgttgacac |
38056122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 29046081 - 29046025
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
29046081 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactct |
29046025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 221 - 280
Target Start/End: Original strand, 6476790 - 6476849
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| || ||||||| |
|
|
| T |
6476790 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgtctctctc |
6476849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 212 - 269
Target Start/End: Complemental strand, 235653 - 235596
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
235653 |
aaatagacggttgagatttggtgtcaacgaatccgttgacacctggtgtcaatggatc |
235596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 211 - 276
Target Start/End: Complemental strand, 19128832 - 19128767
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||| || ||| ||||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
19128832 |
aaaataaacggttaagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
19128767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 28705878 - 28705933
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
28705878 |
gttgagatttagtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
28705933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 227 - 277
Target Start/End: Complemental strand, 234747 - 234697
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
234747 |
atttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactct |
234697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 29087975 - 29087921
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
29087975 |
tgagatttggtgtcaatgaatccgttgacacctggtgtcaacggatcctgactct |
29087921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 212 - 269
Target Start/End: Original strand, 236919 - 236976
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| ||||||||||||| || ||||||||||||||||||||||| || ||||| |
|
|
| T |
236919 |
aaatagacggttgagatttggtgtctacgaatccgttgacacctggtgtcaatggatc |
236976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 276
Target Start/End: Original strand, 237826 - 237875
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
237826 |
atttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
237875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 276
Target Start/End: Complemental strand, 19359750 - 19359701
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
19359750 |
atttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
19359701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 4084932 - 4084876
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||||| |||||||| ||||||| |
|
|
| T |
4084932 |
gttgagatttggtgtcaacgaattcgttgacaccaggtgtcaacggatcctgactct |
4084876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 7632143 - 7632099
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
7632143 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
7632099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 265
Target Start/End: Complemental strand, 10554599 - 10554555
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
10554599 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacg |
10554555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 211 - 275
Target Start/End: Complemental strand, 14478983 - 14478919
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
|||||||||| || | ||||||| |||||||||||||||||||||| ||| |||||||| ||||| |
|
|
| T |
14478983 |
aaaatagacaattaaaatttggtgtcaacgaatccgttgacacctgatgtcaacggatcctgact |
14478919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 27364486 - 27364534
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
27364486 |
gttgagatttggtgtcaacgaatccattgacacctggtgtcaacggatc |
27364534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 268
Target Start/End: Complemental strand, 28705217 - 28705170
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
28705217 |
gttgagatttggtgtaaacgaatccgttgacacctggtgtcaacggat |
28705170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 17071286 - 17071228
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || ||||||||||||| ||||||||| |||||||||||| ||| |||||||| |
|
|
| T |
17071286 |
aaaataaacggttgagatttggtgtcaacgaattcgttgacacctgatgtcaacggatc |
17071228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 34600323 - 34600265
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || ||||||||||||| ||||||||| |||||||||||| ||| |||||||| |
|
|
| T |
34600323 |
aaaataaacggttgagatttggtgtcaacgaattcgttgacacctgatgtcaacggatc |
34600265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 276
Target Start/End: Original strand, 19360481 - 19360530
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
19360481 |
atttggtgtcaacgaattcgttgacacctggtgtcaacggatcctgactc |
19360530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 214 - 271
Target Start/End: Original strand, 20854897 - 20854954
Alignment:
| Q |
214 |
atagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcat |
271 |
Q |
| |
|
|||||| ||| ||||||||| ||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
20854897 |
atagacggttcagatttggtgtcaacgaatccattaacacctggtgtcaacggatcat |
20854954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 1281884 - 1281840
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
1281884 |
agatttggtgtcaacgaatccgttgacacctggtgtcaatggatc |
1281840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 265
Target Start/End: Original strand, 1283503 - 1283543
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
1283503 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacg |
1283543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 1554086 - 1554130
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
1554086 |
agatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
1554130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 230 - 269
Target Start/End: Original strand, 1283533 - 1283572
Alignment:
| Q |
230 |
tggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
1283533 |
tggtgtcaacgaatccgttgacacctggtgtcaacggatc |
1283572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 230 - 269
Target Start/End: Complemental strand, 10554565 - 10554526
Alignment:
| Q |
230 |
tggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
10554565 |
tggtgtcaacgaatccgttgacacctggtgtcaacggatc |
10554526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 269
Target Start/End: Complemental strand, 25858257 - 25858214
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| |||||||| |
|
|
| T |
25858257 |
gatttggtgtcaacgaatccgttgacacctagtgtcaacggatc |
25858214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 211 - 269
Target Start/End: Original strand, 17071783 - 17071841
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || |||| |||||||| ||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
17071783 |
aaaataaacggttgcgatttggtgtcaacgaattcgttaacacctggtgtcaacggatc |
17071841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 218 - 268
Target Start/End: Original strand, 22799756 - 22799806
Alignment:
| Q |
218 |
acagttgagatttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
|||||| ||||||||| ||||||||| | |||||||||||||| ||||||| |
|
|
| T |
22799756 |
acagttaagatttggtgtcaacgaattcattgacacctggtgtcaacggat |
22799806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 261
Target Start/End: Original strand, 27363779 - 27363813
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgtt |
261 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27363779 |
atttggtgtcaacgaatccgttgacacctggtgtt |
27363813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Original strand, 34709038 - 34709084
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||| |||| |
|
|
| T |
34709038 |
tgagatttggtgccaacgaatccgttgacacctggtgtcaacagatc |
34709084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 36038745 - 36038699
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| | |||||||||||||| ||||||||| |||||||| |
|
|
| T |
36038745 |
tgagatttggtgttaacgaatccgttgatacctggtgtcaacggatc |
36038699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 280
Target Start/End: Original strand, 34600820 - 34600889
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
|||||| || |||| |||||||| ||||||||| |||| ||||||||||| || ||||| | |||||||| |
|
|
| T |
34600820 |
aaaataaacggttgcgatttggtgtcaacgaattcgttaacacctggtgtcaagggatcctaactctctc |
34600889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 22798949 - 22798905
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | | |||||||| |
|
|
| T |
22798949 |
agatttggtgtcaacgaatccgttgacacctgatatcaacggatc |
22798905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 33005569 - 33005517
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
|||||| || ||||||||| | ||||||| |||||| |||||||||||||||| |
|
|
| T |
33005569 |
agattttgtgtcaacgaattcattgacacttggtgtcaacggatcatgactct |
33005517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 38056846 - 38056798
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||| ||||||| ||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
38056846 |
gttgaaatttggtgtcaaccaatccgttgacacctggtgtcaacagatc |
38056798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 19)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 4940042 - 4940273
Alignment:
| Q |
13 |
aagaatattgaagaattagcatggaaagaatattgaagagtggatgtggctgagaattacaaagtttcgacgaactaatggcttgaagattcgttcaaat |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
4940042 |
aagaatattgaagaattagcatagaaagaatattaaagagtggatgtggctgagaattacaaagtt-cgacgaactaatggcctgaagattcgttcaaat |
4940140 |
T |
 |
| Q |
113 |
taagcttttagtgaatatgtgatcaaaatcaagtataatcgcgcagtgaaaacaaatgtgagttgatttagtaaacaattataagcttttgattttaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4940141 |
taagcttttagtgaatatgtgatcaaaatcaagtataatcgcgcagtgaaaacagatgtgagttgatttagtaaacaattataagcctttgattttaaaa |
4940240 |
T |
 |
| Q |
213 |
aatagacagttgagatttggtatcaacgaatcc |
245 |
Q |
| |
|
||||||| |||||||| |||| |||||| |||| |
|
|
| T |
4940241 |
aatagacggttgagatatggtgtcaacggatcc |
4940273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 157 - 277
Target Start/End: Original strand, 11434392 - 11434512
Alignment:
| Q |
157 |
agtgaaaacaaatgtgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctg |
256 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||| || |
|
|
| T |
11434392 |
agtgaaaacagatgtgagttgatttcgtaaacaattataagcctttgattttaaaaaatagaaggttgagatttggtgtcaacgaatccgttgacatttg |
11434491 |
T |
 |
| Q |
257 |
gtgttaacggatcatgactct |
277 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
11434492 |
gtgttaacggatactgactct |
11434512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 212 - 277
Target Start/End: Original strand, 26529503 - 26529568
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
26529503 |
aaatagacggttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactct |
26529568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 212 - 276
Target Start/End: Complemental strand, 10171337 - 10171273
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
10171337 |
aaatagacggttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
10171273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 12344956 - 12344898
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
12344956 |
aaaatagacggttgagatttggtatcaacgaatctgttgacacctggtgtcaatggatc |
12344898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 209 - 269
Target Start/End: Original strand, 10171953 - 10172013
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| |||| ||||||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
10171953 |
aaaaaagagacggttgagatttggtgtcaacgaatgcgttgacacctggtgtcaacggatc |
10172013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 209 - 269
Target Start/End: Complemental strand, 26528887 - 26528827
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| |||| ||||||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
26528887 |
aaaaaagagacggttgagatttggtgtcaacgaatgcgttgacacctggtgtcaacggatc |
26528827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 218 - 276
Target Start/End: Complemental strand, 19311056 - 19310998
Alignment:
| Q |
218 |
acagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
19311056 |
acagttgagatttggtgtcaacaaatccgttaacacctggtgtcaacggatcctgactc |
19310998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 8488521 - 8488473
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
8488521 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaatggatc |
8488473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 19323766 - 19323814
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
19323766 |
gttgagatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
19323814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 266
Target Start/End: Complemental strand, 19323033 - 19322990
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacgg |
266 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
19323033 |
tgagatttggtgtcaacgaatccgttgacacctggtgtcaacgg |
19322990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 275
Target Start/End: Original strand, 19311830 - 19311880
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
19311830 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacgaatcctgact |
19311880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 275
Target Start/End: Original strand, 33436277 - 33436327
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
33436277 |
agatttggtgtcaacgaatccgttgacatctggtgtcaacggatcctgact |
33436327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 280
Target Start/End: Complemental strand, 9441287 - 9441230
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| |||| ||| || ||||||| |
|
|
| T |
9441287 |
tgagatttggtgtcaacggatccgttgacacctggtgtcaacgaatcctgtctctctc |
9441230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 18227783 - 18227729
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
18227783 |
gttgtgatttggtgtcaacgaatccgttgaca-ctggtgtcaacggatcctgactc |
18227729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 218 - 269
Target Start/End: Complemental strand, 33435395 - 33435344
Alignment:
| Q |
218 |
acagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| ||||||||| |||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
33435395 |
acagttaagatttggtgtcaacgaatccgttaacaccaggtgtcaacggatc |
33435344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 3623237 - 3623179
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || ||||||||||||| |||| |||| |||||||||||| ||| |||||||| |
|
|
| T |
3623237 |
aaaataaacggttgagatttggtgtcaaagaattcgttgacacctgatgtcaacggatc |
3623179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 276
Target Start/End: Original strand, 8489284 - 8489334
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||| | ||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
8489284 |
gatttggtgttaacgaattcgttgacacctggtgtcaacggatcctgactc |
8489334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 265
Target Start/End: Complemental strand, 5861938 - 5861894
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
||||||||||||| |||||||||| |||| |||||||||| |||| |
|
|
| T |
5861938 |
gttgagatttggtgtcaacgaatctgttggcacctggtgtcaacg |
5861894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 4e-32; HSPs: 46)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 171 - 269
Target Start/End: Original strand, 3772476 - 3772574
Alignment:
| Q |
171 |
tgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| |||||||||||| ||| |||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
3772476 |
tgagttgatttcgtaaacaattattagcctttgattttaaaaaatagacggttgagatttggtgtcaacgaatacgttgacacctggtgtcaacggatc |
3772574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 168 - 269
Target Start/End: Original strand, 45931164 - 45931265
Alignment:
| Q |
168 |
atgtgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacgga |
267 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| ||| |||||||||||| |||||| ||||||||||| ||||||||||||| |
|
|
| T |
45931164 |
atgtgagttgatttagtaaataattataagcttttgatttataaaaatggacgattgagatttggtgtcaacggatccgttgacatatggtgttaacgga |
45931263 |
T |
 |
| Q |
268 |
tc |
269 |
Q |
| |
|
|| |
|
|
| T |
45931264 |
tc |
45931265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 221 - 280
Target Start/End: Complemental strand, 26636155 - 26636096
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
26636155 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactctctc |
26636096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 185 - 269
Target Start/End: Original strand, 30661419 - 30661503
Alignment:
| Q |
185 |
aaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| ||||||||| ||||||| | ||||| || ||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
30661419 |
aaactattataagcctttgattaaataaaatcaacggttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
30661503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 185 - 269
Target Start/End: Complemental strand, 37949693 - 37949609
Alignment:
| Q |
185 |
aaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| ||||||||| ||||||| | ||||| || ||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
37949693 |
aaactattataagcctttgattaaataaaatcaacggttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
37949609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 46428239 - 46428184
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
46428239 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
46428184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 7668534 - 7668480
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
7668534 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgact |
7668480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 25599073 - 25599019
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
25599073 |
ttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
25599019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 25342549 - 25342501
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
25342549 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
25342501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 25343355 - 25343307
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
25343355 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
25343307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 198 - 277
Target Start/End: Original strand, 25343216 - 25343295
Alignment:
| Q |
198 |
cttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||| ||||||| || ||||||||||||| ||||||||| | |||||||||||||| |||||||| ||||||| |
|
|
| T |
25343216 |
cttttgattaaaaaaaattgatggttgagatttggtgtcaacgaattcattgacacctggtgtcaacggatcctgactct |
25343295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 26636860 - 26636914
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
26636860 |
gttgagatttggtgtcaacgaatccgttgacaccttgtgtcaacggatcctgact |
26636914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 30660643 - 30660597
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
30660643 |
tgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
30660597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 269
Target Start/End: Original strand, 37950469 - 37950515
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
37950469 |
tgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
37950515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 276
Target Start/End: Original strand, 45099899 - 45099948
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
45099899 |
atttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
45099948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 13785597 - 13785641
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
13785597 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
13785641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 275
Target Start/End: Original strand, 18977720 - 18977823
Alignment:
| Q |
171 |
tgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatca |
270 |
Q |
| |
|
|||||| ||||| ||||||||| || |||| |||| ||||||| || ||||||||||||| | |||||||||||||||||||||||| || ||||| |
|
|
| T |
18977720 |
tgagttaatttaagaaacaattacaacctttggatta-aaaaaattgatggttgagatttggtgttaacgaatccgttgacacctggtgtcaatggatcc |
18977818 |
T |
 |
| Q |
271 |
tgact |
275 |
Q |
| |
|
||||| |
|
|
| T |
18977819 |
tgact |
18977823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 19067689 - 19067641
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
19067689 |
gttgagatttggtgtcaacgaatccgttgacacgtggtgtcaacggatc |
19067641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 24389616 - 24389664
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
24389616 |
gttgagatttggtgtcaatgaatccgttgacacctggtgtcaacggatc |
24389664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 27948498 - 27948450
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
27948498 |
gttgagatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
27948450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 43065120 - 43065164
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
43065120 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
43065164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 218 - 269
Target Start/End: Complemental strand, 45162024 - 45161973
Alignment:
| Q |
218 |
acagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| || ||||| |
|
|
| T |
45162024 |
acagttgagatttggtgtcaacgaatccgttaacacctggtgtcaatggatc |
45161973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 263
Target Start/End: Complemental strand, 3028026 - 3027984
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaa |
263 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
3028026 |
gttgagatttggtgtcaacgaattcgttgacacctggtgttaa |
3027984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 46428819 - 46428873
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||| | ||||||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
46428819 |
tgagatttgatgtcaacgaattcgttgacacctggtgtcaacggatcctgactct |
46428873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 3903340 - 3903393
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
|||| ||||||| |||||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
3903340 |
ttgatatttggtgtcaacggatccgttgacacctggtgtcaacggatcctgact |
3903393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 40273612 - 40273555
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctc |
278 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||||||| |||||||| | |||||| |
|
|
| T |
40273612 |
gttgagatttggtgtcaacgaattcattgacacctggtgtcaacggatcctaactctc |
40273555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 1417656 - 1417612
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
1417656 |
agatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
1417612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 3029198 - 3029246
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
3029198 |
gttgggatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
3029246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 16664125 - 16664173
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
16664125 |
gttgagatttagtgtcaacggatccgttgacacctggtgtcaacggatc |
16664173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 17638485 - 17638533
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
17638485 |
gttgagatttagtgtcaacggatccgttgacacctggtgtcaacggatc |
17638533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 19068395 - 19068443
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
19068395 |
gttgaaatttggtgtcaacgaatacgttgacacctggtgtcaacggatc |
19068443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 21496983 - 21497031
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| ||| |||||||| |
|
|
| T |
21496983 |
gttgagatttggtgtcaacgaattcgttgacacctgttgtcaacggatc |
21497031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 38225979 - 38226023
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
38225979 |
agatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
38226023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 47719708 - 47719752
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
47719708 |
agatttggtgtcaacgaatccgttgacacctggtgtcaatggatc |
47719752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 24719386 - 24719339
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
24719386 |
ttgatatttggtgtcaacgaatccgttgacatctggtgtcaacggatc |
24719339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 269
Target Start/End: Original strand, 31278159 - 31278202
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
31278159 |
gatttggtgtcaacgaatccgttgacatctggtgtcaacggatc |
31278202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 211 - 269
Target Start/End: Original strand, 3219536 - 3219594
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || |||||||||| || ||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
3219536 |
aaaataaacggttgagattttgtgtcaacgaattcgttaacacctagtgttaacggatc |
3219594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 14686181 - 14686135
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
14686181 |
tgagatttggtgtcaacaaatccgttgacacttggtgtcaacggatc |
14686135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 269
Target Start/End: Original strand, 37395505 - 37395547
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
37395505 |
atttggtgttaacgaatccgttgacacctggtgtcaacggatc |
37395547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 276
Target Start/End: Complemental strand, 38225347 - 38225297
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||| | |||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
38225347 |
gatttggtgttaacggattcgttgacacctggtgtcaacggatcatgactc |
38225297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 25599821 - 25599874
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||| |||| ||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
25599821 |
tgagatttggtgtcaatgaatctattgacacctggtgtcaacggatcctgactc |
25599874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 3688432 - 3688388
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||| | ||||||| |||||||| |
|
|
| T |
3688432 |
agatttggtgtcaacgaatccgttgatatctggtgtcaacggatc |
3688388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 14305138 - 14305094
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||| |||||||||||||||| |||| |||||||| |
|
|
| T |
14305138 |
agatttggtgtcaatgaatccgttgacacctagtgtcaacggatc |
14305094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 265
Target Start/End: Original strand, 24453730 - 24453770
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
24453730 |
agatttggtgtcaacaaatccgttgacacctggtgtcaacg |
24453770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 227 - 263
Target Start/End: Complemental strand, 31277469 - 31277433
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaa |
263 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
31277469 |
atttggtgtcaacgaattcgttgacacctggtgttaa |
31277433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 37706480 - 37706424
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||| ||||||| | |||||||||||||| ||||||||| || ||||| ||||||| |
|
|
| T |
37706480 |
gttgaaatttggtgttaacgaatccgttgatacctggtgtcaatggatcctgactct |
37706424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 168 - 269
Target Start/End: Original strand, 8238 - 8339
Alignment:
| Q |
168 |
atgtgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacgga |
267 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||||||||||||| ||||||||||||| | ||||||| |||||||||||||||| || ||| |
|
|
| T |
8238 |
atgtgagttgatttcataaacaattattagcctttgattttaaaaaatagacggttgagatttggtgttaacgaatacgttgacacctggtgtcaatgga |
8337 |
T |
 |
| Q |
268 |
tc |
269 |
Q |
| |
|
|| |
|
|
| T |
8338 |
tc |
8339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 4e-26; HSPs: 54)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 168 - 276
Target Start/End: Original strand, 53148559 - 53148666
Alignment:
| Q |
168 |
atgtgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacgga |
267 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| |||||||| ||||||||||| ||||||||||||| |||||||||| ||||||||||| ||| || ||| |
|
|
| T |
53148559 |
atgtgagttaatttagtaagcaattataagcctttgattt-aaaaaatagacggttgagatttggtgtcaacgaatctgttgacacctgatgtcaatgga |
53148657 |
T |
 |
| Q |
268 |
tcatgactc |
276 |
Q |
| |
|
|| |||||| |
|
|
| T |
53148658 |
tcctgactc |
53148666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 221 - 280
Target Start/End: Original strand, 47785799 - 47785858
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||| |||| |||||||||| |
|
|
| T |
47785799 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacagatcctgactctctc |
47785858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 211 - 269
Target Start/End: Original strand, 47688469 - 47688527
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || ||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
47688469 |
aaaataaacggttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
47688527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 53732498 - 53732440
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||| || |||||||||||||||||||||||||| |||||||| |
|
|
| T |
53732498 |
aaaatagacggttgagatttagtgtcaacgaatccgttgacacctggtgtcaacggatc |
53732440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 211 - 276
Target Start/End: Original strand, 8248510 - 8248575
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||| ||| ||||||||| |||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
8248510 |
aaaatagacggttaagatttggtgtcaacgaatccgttgacatctggtgtcaacggatcctgactc |
8248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 211 - 276
Target Start/End: Original strand, 8266175 - 8266240
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||| ||| ||||||||| |||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
8266175 |
aaaatagacggttaagatttggtgtcaacgaatccgttgacatctggtgtcaacggatcctgactc |
8266240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 200 - 277
Target Start/End: Original strand, 30573688 - 30573765
Alignment:
| Q |
200 |
tttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||| ||| ||| ||| ||||||||||||| |||||||||||||||||||||||||| || ||||| ||||||| |
|
|
| T |
30573688 |
tttgattaaaaacaatcgacggttgagatttggtgtcaacgaatccgttgacacctggtgtcaatggatcctgactct |
30573765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 9365222 - 9365166
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
9365222 |
gttgagatttggtgtcaacaaattcgttgacacctggtgttaacggatcctgactct |
9365166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 20774180 - 20774235
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
20774180 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaatggatcctgactc |
20774235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 211 - 277
Target Start/End: Complemental strand, 8247759 - 8247693
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||| ||| |||||| || |||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
8247759 |
aaaatagacggttaagattttgtgtcaacgaatccgttgacaccaggtgtcaacggatcctgactct |
8247693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 280
Target Start/End: Complemental strand, 2444419 - 2444366
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
2444419 |
atttggtgtcaacgaatccgttgacacctggtgtcaacggatcctaactctctc |
2444366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 254
Target Start/End: Complemental strand, 7841880 - 7841811
Alignment:
| Q |
185 |
aaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacc |
254 |
Q |
| |
|
||||||||||| |||| ||||| | |||||||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
7841880 |
aaacaattatagtctttggatttaataaaatagatagttgagatttggtgtcaacgaattcgttgacacc |
7841811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 265
Target Start/End: Original strand, 16903643 - 16903687
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16903643 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacg |
16903687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 24374842 - 24374786
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| ||||||| |||||||| ||||||| |
|
|
| T |
24374842 |
gttgagatttggtgtcaacgaattcgttgacagctggtgtcaacggatcctgactct |
24374786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 26147032 - 26147080
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
26147032 |
gttgagatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
26147080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 209 - 269
Target Start/End: Original strand, 32089601 - 32089661
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| | || |||||||||||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
32089601 |
aaaaaatagacggatgtgatttggtatcaacgaattcgttgacatctggtgtcaacggatc |
32089661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 209 - 269
Target Start/End: Complemental strand, 56262543 - 56262483
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||| | |||||||||||||| |||||||| |
|
|
| T |
56262543 |
aaaatatagacggttgagatttggtgtcaacgaattcattgacacctggtgtcaacggatc |
56262483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 599302 - 599349
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
599302 |
ttgagatttggtgtcaacgaatccgttgacaccaggtgtcaacggatc |
599349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 40348143 - 40348194
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatg |
272 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
40348143 |
gttgagatttggtattaacgaattcattgacacctggtgtcaacggatcatg |
40348194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 269
Target Start/End: Complemental strand, 52871346 - 52871303
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
52871346 |
gatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
52871303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 268
Target Start/End: Complemental strand, 55976215 - 55976172
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
55976215 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacggat |
55976172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 8265424 - 8265366
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||| |||||| || |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
8265424 |
aaaatagacggttaagattttgtgtcaacgaatccgttgacaccaggtgtcaacggatc |
8265366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 209 - 267
Target Start/End: Original strand, 9365804 - 9365862
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacgga |
267 |
Q |
| |
|
||||||| ||| |||| |||||||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
9365804 |
aaaaaattgacggttgtgatttggtgtcaatgaatccgttgacacctggtgtcaacgga |
9365862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 276
Target Start/End: Original strand, 31329722 - 31329772
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
31329722 |
gatttggtgttaacgaatccgttgacacctggtgtcaacggatcctgactc |
31329772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 268
Target Start/End: Complemental strand, 53733179 - 53733125
Alignment:
| Q |
214 |
atagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||| ||||||| ||||||| |
|
|
| T |
53733179 |
atagacggttgagatttggtatcaacgaattcgttaacagctggtgtcaacggat |
53733125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 53772854 - 53772812
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
53772854 |
atttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
53772812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 269
Target Start/End: Original strand, 55001430 - 55001488
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || ||| |||||| || |||||||||||||||||||||||||| |||||||| |
|
|
| T |
55001430 |
aaaataaacggttaagatttagtgtcaacgaatccgttgacacctggtgtcaacggatc |
55001488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 211 - 256
Target Start/End: Complemental strand, 5046047 - 5046002
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctg |
256 |
Q |
| |
|
|||||| || ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5046047 |
aaaataaacggttgagatttggtgtcaacgaatccgttgacacctg |
5046002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 7841595 - 7841542
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| ||| |||||||| |||||| |
|
|
| T |
7841595 |
tgagatttggtgtcaacgaatccgttaacacctgatgtcaacggatcctgactc |
7841542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 226 - 275
Target Start/End: Complemental strand, 44469540 - 44469491
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
44469540 |
gatttggtgtcaacgaattcgttgacacctggtgtcatcggatcatgact |
44469491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 11938764 - 11938716
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
11938764 |
gttgagatttggtgtcaacgaattcgttgacacctggtgtgaacagatc |
11938716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 19080438 - 19080390
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||| ||| |||| |
|
|
| T |
19080438 |
gttgaaatttggtgtcaacgaatccgttgacacctggtgtcaacagatc |
19080390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 260
Target Start/End: Original strand, 53733722 - 53733770
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
||||||| ||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
53733722 |
aaatagatggttgaaatttggtgtcaacgaatccgttgacacctggtgt |
53733770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 53773590 - 53773634
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| |||||||| |
|
|
| T |
53773590 |
agatttggtgtcaacgaatccgttgacacctgatgtcaacggatc |
53773634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 269
Target Start/End: Original strand, 3654520 - 3654563
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
3654520 |
gatttggtgtcaacgaatccgttgacacctggcgtcaacggatc |
3654563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 24158824 - 24158875
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| || ||||| |||||| |
|
|
| T |
24158824 |
agatttggtgtcaacgaatctgttgacacctggtgtcaatggatcctgactc |
24158875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 269
Target Start/End: Original strand, 42882686 - 42882729
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
42882686 |
gatttggtgtcaacgaatccgttgacatctggtgtcaacggatc |
42882729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 260
Target Start/End: Original strand, 55976959 - 55976994
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55976959 |
agatttggtgtcaacgaatccgttgacacctggtgt |
55976994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Original strand, 2446163 - 2446209
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||| |||||||| |
|
|
| T |
2446163 |
tgagatttggtgttaacgaatctgttgacacctggtgtcaacggatc |
2446209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 230 - 276
Target Start/End: Original strand, 16903677 - 16903723
Alignment:
| Q |
230 |
tggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
16903677 |
tggtgtcaacgaatccgttgacacctggtgtcaacgaatcctgactc |
16903723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 19550333 - 19550291
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
19550333 |
atttggtgtcaacgaatccgttgacacctggtgtcaagggatc |
19550291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 265
Target Start/End: Original strand, 43146650 - 43146692
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
43146650 |
tgagatttggtgtcaaggaatccgttgacacctggtgtcaacg |
43146692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 47687972 - 47687914
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || |||| |||||||| ||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
47687972 |
aaaataaacggttgcgatttggtgtcaacgaattcgttaacacctggtgtcaacggatc |
47687914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 260
Target Start/End: Original strand, 56263022 - 56263111
Alignment:
| Q |
170 |
gtgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
|||||| |||||| |||||||||| | |||| |||| |||| |||||| ||||||||||||| | |||| || |||||||||||||||| |
|
|
| T |
56263022 |
gtgagtagatttaacaaacaattatgaactttggatta-aaaatatagacggttgagatttggtgtaaacggattcgttgacacctggtgt |
56263111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 269
Target Start/End: Original strand, 7842520 - 7842577
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| |||||||||||| ||| || ||||| |
|
|
| T |
7842520 |
aaatagatggttgagatttggtgtcaacgaattcgttgacacctgatgtcaatggatc |
7842577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 40495146 - 40495093
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||| |||||| ||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
40495146 |
tgaggtttggtgtcaacgaatttgttgacacctggtgtcaacggatcctgactc |
40495093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 1465373 - 1465317
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
|||| |||||| | |||| ||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
1465373 |
gttgtgatttgatgtcaatgaatctgttgacacctggtgtcaacggatcctgactct |
1465317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 1866396 - 1866348
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||| |||| |||||||| |
|
|
| T |
1866396 |
gttgagatttggtgtcaacgaattcattgacacctagtgtcaacggatc |
1866348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 11939441 - 11939489
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
11939441 |
gttgagatttcgtgtcaacgaatccgttgacactaggtgtcaacggatc |
11939489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 24551927 - 24551971
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| || ||||| |
|
|
| T |
24551927 |
agatttggtgtcaacaaatccgttgacacctggtgtcaatggatc |
24551971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 26159621 - 26159669
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||| || ||| |||||||| |
|
|
| T |
26159621 |
gttgcgatttggtgtcaacgaatccgttgacacttgatgtcaacggatc |
26159669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 226 - 258
Target Start/End: Complemental strand, 32088867 - 32088835
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggt |
258 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32088867 |
gatttggtgtcaacgaatccgttgacacctggt |
32088835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 53147924 - 53147876
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| ||||||| || ||||| |
|
|
| T |
53147924 |
gttgggatttggtgtcaacgaatccgttgacatctggtgtcaatggatc |
53147876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 55000736 - 55000692
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| || ||||| |
|
|
| T |
55000736 |
agatttggtgtcaacgaatccgttgacatctggtgtcaatggatc |
55000692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 4e-26; HSPs: 42)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 170 - 254
Target Start/End: Complemental strand, 44699965 - 44699881
Alignment:
| Q |
170 |
gtgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacc |
254 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
44699965 |
gtgagttgatttagtaaataattataagccattgatttttaaaaatagacggttgagatttggtgtcaacgaatccgttgacacc |
44699881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 209 - 276
Target Start/End: Original strand, 52266441 - 52266508
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| |||| |||||||||||||||||||| |||||| |
|
|
| T |
52266441 |
aaaaaatagacggttgagatttggtgtcaacgaattcgttaacacctggtgttaacggatcctgactc |
52266508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 265099 - 265152
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
265099 |
ttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcatgact |
265152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 46150729 - 46150785
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
46150729 |
gttgagatttggtgtcaacgaatccgttgacacctagtgtcaacggatcctgactct |
46150785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 210 - 269
Target Start/End: Complemental strand, 31974715 - 31974656
Alignment:
| Q |
210 |
aaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
31974715 |
aaaaatagatggttgagatttggtgtcaacgaatccgttgacacttggtgtcaacggatc |
31974656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 185 - 260
Target Start/End: Complemental strand, 48413407 - 48413333
Alignment:
| Q |
185 |
aaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
|||||||||| ||| ||||||| ||||||| ||| |||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
48413407 |
aaacaattattagcctttgattg-aaaaaattgacggttgtgatttggtgtcaacgaatccgttgacacctggtgt |
48413333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 209 - 280
Target Start/End: Original strand, 48507020 - 48507091
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||| | |||||||||||||| |||||||| || ||||||| |
|
|
| T |
48507020 |
aaaatatagacggttgagatttggtgtcaacgaattcattgacacctggtgtcaacggatcctgtctctctc |
48507091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 225 - 276
Target Start/End: Complemental strand, 48648252 - 48648201
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
48648252 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
48648201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 14871204 - 14871150
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
14871204 |
tgagatttggtgtcaacgaattcgttgacacctggtgtcaacggatcctgactct |
14871150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 212 - 265
Target Start/End: Complemental strand, 17605768 - 17605715
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
|||||||| ||||| ||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
17605768 |
aaatagacggttgaaatttggtgtcaacgaatccgttgacacctggtgtcaacg |
17605715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 17603217 - 17603173
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
17603217 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
17603173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 21727533 - 21727577
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
21727533 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
21727577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 31114994 - 31114943
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
31114994 |
gttgagatttggtatcaacgaatccgttgacac---gtgttaacggatcctgact |
31114943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 41458086 - 41458030
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| | |||| ||| ||||||| |
|
|
| T |
41458086 |
gttgagatttggtgtcaacgaatccgttgacacctggtatcaacgaatcctgactct |
41458030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 268
Target Start/End: Complemental strand, 981720 - 981673
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| ||||||| |
|
|
| T |
981720 |
gttgagatttggtgtcaacgaattcgttgacacctggtgtcaacggat |
981673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 45081403 - 45081458
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
45081403 |
gttgagatttggtgtcaacgaatccgttgacactaggtgtcaacggatcctgactc |
45081458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 277
Target Start/End: Original strand, 55373712 - 55373762
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
55373712 |
atttggtgtcaacgaatccgttgacacctggtgtcaacgaatcctgactct |
55373762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 226 - 271
Target Start/End: Complemental strand, 11652341 - 11652296
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcat |
271 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
11652341 |
gatttggtgtcaacgaatccgttgacacctgatgttaatggatcat |
11652296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 280
Target Start/End: Original strand, 30222104 - 30222157
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| ||| |||||||||| |
|
|
| T |
30222104 |
atttggtatcaacgaatctattgacacctggtgtcaacgaatcctgactctctc |
30222157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 37520561 - 37520614
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgac |
274 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| | |||||||| |||| |
|
|
| T |
37520561 |
gttgagatttggtgtcaacgaattcgttgacacctggtatcaacggatcctgac |
37520614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 37988220 - 37988273
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||| || ||||| |||||| |
|
|
| T |
37988220 |
tgagatttggtgtcaacgaattcgttgacacctggtgtcaatggatcctgactc |
37988273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 276
Target Start/End: Original strand, 52605489 - 52605538
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
52605489 |
atttggtatcatcgaattcgttgacacctggtgtcaacggatcctgactc |
52605538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 276
Target Start/End: Complemental strand, 48764551 - 48764475
Alignment:
| Q |
200 |
tttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| ||| ||| ||| ||||||||||||| ||||||||| |||||||||||| ||| || ||||| |||||| |
|
|
| T |
48764551 |
tttgattaaaaacaatcgacggttgagatttggtgtcaacgaattcgttgacacctgatgtcaatggatcctgactc |
48764475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 269
Target Start/End: Original strand, 10847914 - 10847957
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
10847914 |
gatttggtgtcaatgaatctgttgacacctggtgttaacggatc |
10847957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 221 - 260
Target Start/End: Original strand, 13477778 - 13477817
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
13477778 |
gttgagatttggtgtcaacgaattcgttgacacctggtgt |
13477817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 260
Target Start/End: Original strand, 17603965 - 17604000
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17603965 |
agatttggtgtcaacgaatccgttgacacctggtgt |
17604000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 277
Target Start/End: Original strand, 20213536 - 20213587
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||| |||||||| ||||||| |
|
|
| T |
20213536 |
gatttggtgtcaacgaattcgtcgacacctggtgtcaacggatcctgactct |
20213587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 31115600 - 31115647
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| |||| |||||||| |
|
|
| T |
31115600 |
ttgagatttggtgtcaacgaatctgttgacacctagtgtcaacggatc |
31115647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 209 - 272
Target Start/End: Complemental strand, 48506502 - 48506440
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatg |
272 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
48506502 |
aaaatatagacggttgagatttggtgtcaacgaattcgttgacacc-agtgtcaacggatcatg |
48506440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 209 - 268
Target Start/End: Original strand, 52282400 - 52282459
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
||||||| ||| |||| ||||||| |||| ||||||||||||||||||||| ||||||| |
|
|
| T |
52282400 |
aaaaaattgacggttgtaatttggtgtcaatgaatccgttgacacctggtgtcaacggat |
52282459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 276
Target Start/End: Complemental strand, 13477105 - 13477055
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||| |||| |||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
13477105 |
gatttggtgtcaatgaattcgttgacacctggtgtcaacggatcctgactc |
13477055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 20213028 - 20212986
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||| ||||||| |
|
|
| T |
20213028 |
gatttggtgtcaacgaattcgttgacacctggtgtcaacggat |
20212986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 37987280 - 37987238
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
37987280 |
atttggtgtcaacgaatccattgacacctggtgtcaacggatc |
37987238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 269
Target Start/End: Original strand, 40872814 - 40872856
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
40872814 |
atttggtgtcaatgaatccgttgacacctggtgtcaacggatc |
40872856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 275
Target Start/End: Original strand, 48765074 - 48765124
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| || ||||| ||||| |
|
|
| T |
48765074 |
agatttggtgtcaacgaatccattgacacctggtgtcaatggatcctgact |
48765124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 275
Target Start/End: Original strand, 51827498 - 51827548
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
51827498 |
agatttggtgacaacgaatccgttgacaccaggtgtcaacggatcttgact |
51827548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 52281819 - 52281761
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctct |
279 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
52281819 |
gttgagatctggtgtcaacgaatccgttgacaccaggtatcaacggattctgactctct |
52281761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 254
Target Start/End: Original strand, 29856683 - 29856716
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacc |
254 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
29856683 |
gttgagatttggtgtcaacgaatccgttgacacc |
29856716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 260
Target Start/End: Original strand, 44699826 - 44699859
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
44699826 |
atttggtgtcaacgaatccgttgacacctggtgt |
44699859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 48649177 - 48649226
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgac |
274 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| || ||||| |||| |
|
|
| T |
48649177 |
agatttggtgtcaacgaatctgttgacacctggtgtcaatggatcctgac |
48649226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 46149678 - 46149634
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| || ||||| |
|
|
| T |
46149678 |
agatttggtgtcaacgaatccattgacacctggtgtcaatggatc |
46149634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 51469283 - 51469327
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||| |||||||| |
|
|
| T |
51469283 |
agatttggtgtcaacgaatccgttgacacttgatgtcaacggatc |
51469327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 25)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 168 - 269
Target Start/End: Original strand, 3291483 - 3291581
Alignment:
| Q |
168 |
atgtgagttgatttagtaaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacgga |
267 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||| |||||||||||||||||||| ||||||||||||| | ||||| |||||||| ||||||| ||| || |
|
|
| T |
3291483 |
atgtgagttgatttcgtaaataattattagcctttgattttaaaaaatagacggttgagatttggtgt---cgaatacgttgacatctggtgtcaacaga |
3291579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 211 - 276
Target Start/End: Original strand, 26654367 - 26654432
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||| ||| ||||||||| ||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
26654367 |
aaaatagacggttaagatttggtgtcaacgaatccattgacacctggtgtcaacggatcttgactc |
26654432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 41974691 - 41974638
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
41974691 |
tgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
41974638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 38576301 - 38576349
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
38576301 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
38576349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 211 - 280
Target Start/End: Complemental strand, 22320437 - 22320368
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||||||| || ||||||||| ||||||||||||||||||||||| | |||||||| |||||||||| |
|
|
| T |
22320437 |
aaaatagacgattaagatttggtgtcaacgaatccgttgacacctggcatcaacggatcctgactctctc |
22320368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 3165125 - 3165176
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
3165125 |
agatttggtgtcaacgaatccgttgacacctgatgtcaacggatcctgactc |
3165176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 280
Target Start/End: Complemental strand, 31641560 - 31641505
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| || ||||| |||||||||| |
|
|
| T |
31641560 |
agatttggtgtcaacgaatccattgacacctggtgtcaatggatcctgactctctc |
31641505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 277
Target Start/End: Original strand, 8373698 - 8373748
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
8373698 |
atttggtgtcaacgaatccgttgacacttggtgtcaacggatcctgactct |
8373748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 269
Target Start/End: Complemental strand, 31602075 - 31602021
Alignment:
| Q |
215 |
tagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||| ||||||||||||| ||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
31602075 |
tagacggttgagatttggtgtcaacgaattcgttgacacctggtgtcaaccgatc |
31602021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 189 - 275
Target Start/End: Complemental strand, 37064900 - 37064815
Alignment:
| Q |
189 |
aattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
|||||| ||||||||||| ||||||| ||| |||| |||||||| |||| |||| |||||||||||||||| ||| |||| ||||| |
|
|
| T |
37064900 |
aattattagcttttgatta-aaaaaattgacggttgtgatttggtgtcaatgaattcgttgacacctggtgtcaacagatcctgact |
37064815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 228 - 277
Target Start/End: Complemental strand, 37732872 - 37732823
Alignment:
| Q |
228 |
tttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
37732872 |
tttggtgtcaacgaatccgttgacaccaggtgtcaacggatcctgactct |
37732823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 256
Target Start/End: Complemental strand, 8298309 - 8298265
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctg |
256 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
8298309 |
aaatagacggttgagatttggtgtcaacgaatccgttaacacctg |
8298265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 276
Target Start/End: Original strand, 31642065 - 31642141
Alignment:
| Q |
200 |
tttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| ||| ||| ||| ||||||||||||| ||||||||| |||||||| ||||||| || ||||| |||||| |
|
|
| T |
31642065 |
tttgattaaaaacaatcgacggttgagatttggtgtcaacgaattcgttgacatctggtgtcaatggatcctgactc |
31642141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 32414527 - 32414571
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||| |||| |
|
|
| T |
32414527 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacagatc |
32414571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 8996973 - 8997028
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||||| | |||||||| |||||| |
|
|
| T |
8996973 |
gttgagatttggtgtcaacaaatcagttgacacctggtatcaacggatcctgactc |
8997028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 8372960 - 8372918
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
8372960 |
atttggtgtcaacgaatccgttgacaccaggtgtcaacggatc |
8372918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 9197143 - 9197101
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||| ||||||| |
|
|
| T |
9197143 |
gatttggtgtcaacgaattcgttgacacctggtgtcaacggat |
9197101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 259
Target Start/End: Complemental strand, 11686275 - 11686241
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtg |
259 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11686275 |
agatttggtgtcaacgaatccgttgacacctggtg |
11686241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 276
Target Start/End: Complemental strand, 26652341 - 26652291
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||| | ||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
26652341 |
gatttggtgttaacgaattcgttgacacctggtgtcaacggatcctgactc |
26652291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 280
Target Start/End: Original strand, 32979828 - 32979882
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
|||||||| | ||| ||| |||||||||||||||| |||||||| |||||||||| |
|
|
| T |
32979828 |
gatttggtgttaacaaattcgttgacacctggtgtcaacggatcctgactctctc |
32979882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 266
Target Start/End: Complemental strand, 38628328 - 38628258
Alignment:
| Q |
196 |
agcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacgg |
266 |
Q |
| |
|
|||||||||| |||||||| || ||| |||||| || |||||||||||||||| ||||||||| ||||| |
|
|
| T |
38628328 |
agcttttgatcaaaaaaaataaacggttaagattttgtgtcaacgaatccgttgatacctggtgtcaacgg |
38628258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 209 - 269
Target Start/End: Original strand, 45907 - 45967
Alignment:
| Q |
209 |
aaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||| ||||| ||||||| ||||||||| | ||||||||||||| |||||||| |
|
|
| T |
45907 |
aaaatatagacggttgatatttggtgtcaacgaattcattgacacctggtgccaacggatc |
45967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 27441515 - 27441471
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| | ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
27441515 |
agatttgatgtcaacgaattcgttgacacctggtgtcaacggatc |
27441471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 28929894 - 28929850
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| || ||||| |
|
|
| T |
28929894 |
agatttggtgtcaacgaatccgttgacatctggtgtcaatggatc |
28929850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 37025058 - 37025011
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
37025058 |
gttgagatttggtgtcaacgaatctgttgaca-ctggtgtcaacggatc |
37025011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 38)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 196 - 277
Target Start/End: Original strand, 13263491 - 13263572
Alignment:
| Q |
196 |
agcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||| || | |||||| ||||||||||||| ||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
13263491 |
agcttttgattatagactatagacggttgagatttggtgtcaacgaatccattgacacctggtgtcaacggatcctgactct |
13263572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 214 - 265
Target Start/End: Original strand, 46812180 - 46812231
Alignment:
| Q |
214 |
atagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46812180 |
atagacggttgagatttggtgtcaacgaatccgttgacacctggtgttaacg |
46812231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 25469090 - 25469142
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
25469090 |
agatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactct |
25469142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 30663410 - 30663354
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
30663410 |
gttgagatttggtgtcaacgaatccgttgatacctggtgtcaacggatcctgactct |
30663354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 34309230 - 34309278
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
34309230 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
34309278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 4433848 - 4433895
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
4433848 |
ttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
4433895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 30663976 - 30664031
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
30663976 |
gttgagatttggtgtcaacgaatccgttgacaccaggtgtcaacggatcctgactc |
30664031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 49680861 - 49680815
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
49680861 |
tgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
49680815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 276
Target Start/End: Original strand, 37853141 - 37853190
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
37853141 |
atttggtgtcaacgaatccgttgacacctgatgttaacggatcctgactc |
37853190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 208 - 276
Target Start/End: Complemental strand, 7406310 - 7406242
Alignment:
| Q |
208 |
taaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||||||| |||| ||||||||||| |||||||| |||||| |
|
|
| T |
7406310 |
taaaagatagagggttgagatttggtgtcaacgaattcgttaacacctggtgtcaacggatcctgactc |
7406242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 10121552 - 10121600
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
10121552 |
gttgagatttggtgtcaaccaatccgttgacacctggtgtcaacggatc |
10121600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 13262885 - 13262837
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
13262885 |
gttgagatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
13262837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 276
Target Start/End: Complemental strand, 25468583 - 25468507
Alignment:
| Q |
200 |
tttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| ||| ||| ||| ||||||||||||| |||| ||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
25468583 |
tttgattaaaaacaatcgacggttgagatttggtgtcaatgaatccgttgacacctggtgtcaatggatcctgactc |
25468507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 213 - 269
Target Start/End: Complemental strand, 28181593 - 28181537
Alignment:
| Q |
213 |
aatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
28181593 |
aatagacggttgagatttggtgtcaacgaattcgttgacaccaggtgtcaacggatc |
28181537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 30932795 - 30932843
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
30932795 |
gttgagatttggtgccaacgaatccgttgacacctggtgtcaacggatc |
30932843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 4439207 - 4439254
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
4439207 |
ttgagatttggtgtcaacgaatccgttgacaccaggtgtcaacggatc |
4439254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 8987842 - 8987787
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||| ||| |||| |||||| |
|
|
| T |
8987842 |
gttgagatttggtgtcaacgaatccgttgacacctgatgtcaaccgatcctgactc |
8987787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 280
Target Start/End: Complemental strand, 34308525 - 34308466
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||| |||||||| || ||||||| |
|
|
| T |
34308525 |
gttgaaatttggtgtcaacgaatacgttgacacctggtgtcaacggatcctgtctctctc |
34308466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 269
Target Start/End: Original strand, 7559201 - 7559247
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
7559201 |
tgagatttggtgtcaacggatccgttgacacctggtgtcaacggatc |
7559247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 276
Target Start/End: Original strand, 19172580 - 19172630
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
19172580 |
gatttggtgtcaacgaatccgttgacacctggtgtcaatggatcctgactc |
19172630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 269
Target Start/End: Original strand, 28182062 - 28182120
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||| ||||||||| |||| ||||||||||||||||||||| ||| |||| |
|
|
| T |
28182062 |
aaaatagacggttaagatttggtgtcaaagaatccgttgacacctggtgtcaacagatc |
28182120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 168942 - 168894
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
168942 |
gttgagatttggtgtcaatgaatccgctgacacctggtgtcaacggatc |
168894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 8988548 - 8988596
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| | |||||| |
|
|
| T |
8988548 |
gttgagatttggtgtcaaggaatccgttgacacctggtgtcagcggatc |
8988596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 27256712 - 27256760
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
27256712 |
gttgaaatttggtgtcaacgaatacgttgacacctggtgtcaacggatc |
27256760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 275
Target Start/End: Complemental strand, 36389837 - 36389773
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||| || |||||||||| ||| | |||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
36389837 |
aaaatagacggtcgagatttggtgtcagcaaatccgttgacaccaggtgtcaacggatcctgact |
36389773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 47967910 - 47967866
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
47967910 |
agatttggtgtcaacgaatccgttgacacctggtgtcaatggatc |
47967866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 269
Target Start/End: Complemental strand, 10120830 - 10120787
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
10120830 |
gatttggtgtcaaccaatccgttgacacctggtgtcaacggatc |
10120787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 11548851 - 11548804
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| || |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11548851 |
ttgagatttagtgtcaacgaatctgttgacacctggtgtcaacggatc |
11548804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 269
Target Start/End: Original strand, 17172667 - 17172710
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
17172667 |
gatttggcgtcaacgaatccgttgacacctggtgtcaacggatc |
17172710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 226 - 269
Target Start/End: Complemental strand, 24992017 - 24991974
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
24992017 |
gatttggtgtcaacgaatccgttgacacctggtgtcaatggatc |
24991974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 215 - 258
Target Start/End: Complemental strand, 32038535 - 32038492
Alignment:
| Q |
215 |
tagacagttgagatttggtatcaacgaatccgttgacacctggt |
258 |
Q |
| |
|
||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
32038535 |
tagacggttgagatttggtgtcaacgaattcgttgacacctggt |
32038492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 7558499 - 7558453
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
7558499 |
tgagatttggtgtcaacaaatccgttgacacttggtgtcaacggatc |
7558453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 269
Target Start/End: Original strand, 11704810 - 11704856
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||| || ||||| |
|
|
| T |
11704810 |
tgagatttggtgtcaacgaatccgttgacacttggtgtcaatggatc |
11704856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 17171977 - 17171935
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
17171977 |
atttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
17171935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 45818067 - 45818025
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
45818067 |
atttggtgtcaatgaatccgttgacacctggtgtcaacggatc |
45818025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Original strand, 46391880 - 46391914
Alignment:
| Q |
235 |
tcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
46391880 |
tcaacgaatccgttgacacctggtgtcaacggatc |
46391914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 256
Target Start/End: Complemental strand, 23026645 - 23026600
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctg |
256 |
Q |
| |
|
|||||| | |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
23026645 |
aaaataaatagttgagatttgatgtcaacgaatccgttgacacctg |
23026600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 169627 - 169675
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||||||||| |||||||| |
|
|
| T |
169627 |
gttgagatttggtgtcaataaattcgttgacacctggtgtcaacggatc |
169675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 35)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 184 - 280
Target Start/End: Original strand, 22560530 - 22560626
Alignment:
| Q |
184 |
taaacaattataagcttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||| ||| ||||||||||||| | | ||| || ||||||||||||| |||||||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
22560530 |
taaactattgtaagcttttgattaaatataatgtacggttgagatttggtgtcaacgaatccgttgacacctgatgtcaacggatcctgactctctc |
22560626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 198 - 277
Target Start/End: Complemental strand, 1296455 - 1296376
Alignment:
| Q |
198 |
cttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||| ||||||| || ||||||||||||| ||||||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
1296455 |
cttttgattaaaaaaaattgatggttgagatttggtgtcaacgaattcgttgacacctggtgtcaacggatcctgactct |
1296376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 198 - 276
Target Start/End: Original strand, 9276306 - 9276384
Alignment:
| Q |
198 |
cttttgattttaaaaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||| ||||||| || ||||||||||||| ||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
9276306 |
cttttgattaaaaaaaattgatggttgagatttggtgtcaacgaattcgttgacacctggtgtcaacggatcctgactc |
9276384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 1297122 - 1297170
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
1297122 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
1297170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 9275639 - 9275591
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
9275639 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
9275591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 29719499 - 29719451
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
29719499 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
29719451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 36237684 - 36237626
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctct |
279 |
Q |
| |
|
||||| ||||||| |||| ||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
36237684 |
gttgaaatttggtgtcaatgaatccgttgacacctggtgtcaacggatcctgactctct |
36237626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 226 - 271
Target Start/End: Complemental strand, 40252070 - 40252025
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcat |
271 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40252070 |
gatttggtgtcaacgaatccgttgacacctggtgttaatggatcat |
40252025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 11750310 - 11750262
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
11750310 |
gttgagatttggtgtcaacgaatccgttgacacctggtgtcaatggatc |
11750262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 212 - 276
Target Start/End: Complemental strand, 29512433 - 29512369
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||| |||||||||| ||||| ||||||||||||||| |
|
|
| T |
29512433 |
aaatagactattgagatttggtgtcaacaaattcgttgacaccaggtgtcaacggatcatgactc |
29512369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 269
Target Start/End: Original strand, 18174659 - 18174717
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || ||||||||||||| ||||||||| |||||||||||| ||| |||||||| |
|
|
| T |
18174659 |
aaaataaacggttgagatttggtgtcaacgaattcgttgacacctgatgtcaacggatc |
18174717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 277
Target Start/End: Complemental strand, 42459114 - 42459048
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||| |||||||||| | |||||||||| ||||||||||||||| || ||||| ||||||| |
|
|
| T |
42459114 |
aaaatagacgattgagatttgatgtcaacgaatctgttgacacctggtgtcaatggatcctgactct |
42459048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 218 - 275
Target Start/End: Complemental strand, 23343835 - 23343778
Alignment:
| Q |
218 |
acagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| ||||||| ||| |||| ||||| |
|
|
| T |
23343835 |
acagttgagatttgatgtcaacgaatccgttgacatctggtgtcaacagatcctgact |
23343778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 221 - 266
Target Start/End: Original strand, 42182614 - 42182659
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacgg |
266 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
42182614 |
gttgagatttggtgtcaacgaatcccttgacacctggtgtcaacgg |
42182659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 8669195 - 8669243
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
8669195 |
gttgggatttggtgtcaacgaatctgttgacacctggtgttaacagatc |
8669243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 9540380 - 9540336
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
9540380 |
agatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
9540336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 12725614 - 12725662
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
12725614 |
gttgggatttggtgtcaacaaatccgttgacacctggtgtcaacggatc |
12725662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 15902885 - 15902929
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| |||||||| |
|
|
| T |
15902885 |
agattttgtgtcaacgaatccgttgacacctggtgtcaacggatc |
15902929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 22301873 - 22301917
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
22301873 |
agatttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
22301917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 24754995 - 24755047
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
24754995 |
tgagatttggtttcaacgaatcaattgacacctggtgtcaacggatcctgact |
24755047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 29513150 - 29513194
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
29513150 |
agatttggtgtcaacgaatccgttgacacctggtgtcaatggatc |
29513194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 221 - 260
Target Start/End: Original strand, 8542547 - 8542586
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
8542547 |
gttgagatttggtgtcaacgaatccgttgacacctagtgt |
8542586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 221 - 260
Target Start/End: Complemental strand, 11007284 - 11007245
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
11007284 |
gttgagatttagtgtcaacgaatccgttgacacctggtgt |
11007245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 225 - 260
Target Start/End: Original strand, 16692977 - 16693012
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16692977 |
agatttggtgtcaacgaatccgttgacacctggtgt |
16693012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 29559420 - 29559467
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
29559420 |
ttgagatttggtgtcaacgaattcgttgacacctggtgtcaacagatc |
29559467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 18174162 - 18174104
Alignment:
| Q |
211 |
aaaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||||| || |||| |||||||| ||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
18174162 |
aaaataaacggttgcgatttggtgtcaacgaattcgttaacacctggtgtcaacggatc |
18174104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 24933889 - 24933831
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctct |
279 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| ||||| |||||||| || |||||| |
|
|
| T |
24933889 |
gttgagatttggtgtcaatgaattcgttgacaccaggtgtcaacggatcctgtctctct |
24933831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 27177959 - 27177917
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
27177959 |
atttggtgtcaacgaattcgttgacacctggtgtcaacggatc |
27177917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 24121291 - 24121344
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||||||| || ||||| |||||| |
|
|
| T |
24121291 |
tgagatttggtctcaatgaatctgttgacacctggtgtcaatggatcctgactc |
24121344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 15774255 - 15774207
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| ||||| |||||||| |
|
|
| T |
15774255 |
gttgagatttggtgtcaacaaattcgttgacaccaggtgtcaacggatc |
15774207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 212 - 276
Target Start/End: Original strand, 19918712 - 19918776
Alignment:
| Q |
212 |
aaatagacagttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| ||||||||||| | |||||||||||||||||| | | ||| |||||||| |||||| |
|
|
| T |
19918712 |
aaatagaaggttgagatttgatgtcaacgaatccgttgacatcagatgtcaacggatcctgactc |
19918776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 23856688 - 23856640
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||| |||||||| |
|
|
| T |
23856688 |
gttgagatttggtgtcaatcaatccgttgacaccaggtgtcaacggatc |
23856640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 26752726 - 26752770
Alignment:
| Q |
225 |
agatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| | ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
26752726 |
agatttgatgtcaacgaattcgttgacacctggtgtcaacggatc |
26752770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 226 - 274
Target Start/End: Original strand, 34812860 - 34812908
Alignment:
| Q |
226 |
gatttggtatcaacgaatccgttgacacctggtgttaacggatcatgac |
274 |
Q |
| |
|
|||||||| | |||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
34812860 |
gatttggtgttaacgaatccgttgacaactggtgtcaacggatcctgac |
34812908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 265
Target Start/End: Complemental strand, 38361120 - 38361076
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacg |
265 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| ||| |||| |
|
|
| T |
38361120 |
gttgagatttggtgtcaacgaattcgttgacacctgatgtcaacg |
38361076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 26644 - 26589
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
26644 |
gttgtgatttggtgtcaacgaatccgttgacacctggtgtcaacggatcctgactc |
26589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0093 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0093
Description:
Target: scaffold0093; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 280
Target Start/End: Original strand, 23728 - 23787
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactctctc |
280 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| || ||||| | |||||||| |
|
|
| T |
23728 |
gttgagatttggtgtcaacgaatccgttgacaactggtgtcaatggatcctaactctctc |
23787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2007 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold2007
Description:
Target: scaffold2007; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 802 - 748
Alignment:
| Q |
222 |
ttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||| || ||||| |||||| |
|
|
| T |
802 |
ttgagatttggtgtcaacgaatccgttgaaacctggtgtcaatggatcctgactc |
748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 269
Target Start/End: Original strand, 22076 - 22118
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
22076 |
atttggtgtcaacgaatccgttgacacctggtgtcaacggatc |
22118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 15075 - 15020
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
15075 |
gttgagatttggtgtcaatgaatccgttgacactaggtgtcaacggatcctgactc |
15020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 221 - 260
Target Start/End: Original strand, 15858 - 15897
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgt |
260 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
15858 |
gttgagatttggtgtcaacgaattcgttgacacctggtgt |
15897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 15134 - 15080
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgact |
275 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
15134 |
gttgagatttggtgtcaatgaatccgttgacactaggtgtcaacggatcctgact |
15080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0504 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0504
Description:
Target: scaffold0504; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 276
Target Start/End: Original strand, 5385 - 5434
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
5385 |
atttggtgtcaacaaatccgttgacacctggtgtcaacggatcctgactc |
5434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 268
Target Start/End: Complemental strand, 39942 - 39901
Alignment:
| Q |
227 |
atttggtatcaacgaatccgttgacacctggtgttaacggat |
268 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
39942 |
atttggtgtcaacgaatccgttgacacctggtgtcaacggat |
39901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1213 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold1213
Description:
Target: scaffold1213; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 276
Target Start/End: Complemental strand, 1949 - 1893
Alignment:
| Q |
220 |
agttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| ||| ||| |||||||| |||||| |
|
|
| T |
1949 |
agttgtgatttggtgtcaacgaatccgttgacatctgctgtcaacggatcttgactc |
1893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 428901 - 428957
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactct |
277 |
Q |
| |
|
||||||||||||| ||||||||| |||||| ||| ||||| |||||||| ||||||| |
|
|
| T |
428901 |
gttgagatttggtgtcaacgaattcgttgataccgggtgtcaacggatcctgactct |
428957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0418 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0418
Description:
Target: scaffold0418; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 6886 - 6939
Alignment:
| Q |
223 |
tgagatttggtatcaacgaatccgttgacacctggtgttaacggatcatgactc |
276 |
Q |
| |
|
|||| |||||| ||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
6886 |
tgaggtttggtgtcaacgaatttgttgacacctggtgtcaacggatcctgactc |
6939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1207 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold1207
Description:
Target: scaffold1207; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 1639 - 1591
Alignment:
| Q |
221 |
gttgagatttggtatcaacgaatccgttgacacctggtgttaacggatc |
269 |
Q |
| |
|
|||| |||||||| ||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
1639 |
gttgggatttggtgtcaacgaattcgttgacacctggtgtcaaccgatc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University