View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2742_low_29 (Length: 275)
Name: NF2742_low_29
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2742_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 11 - 259
Target Start/End: Original strand, 1584896 - 1585131
Alignment:
| Q |
11 |
caaaggaacccacgaccgaggtataaagttaattcctcagcgttaatcgcttgaagaagatggaatcacaattgaggatattcagccgaacctcgactga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1584896 |
caaaggaacccacgaccgaggtataaagttaattc-------------gcttgaagaagatggaatcacaattgaggatattcagccgaacctcgactga |
1584982 |
T |
 |
| Q |
111 |
atttttgctccaccaacaaatttggcatgcttagtggggcaatatgaactttaccaccgaaaaatctagtaccccaagtcaagactaagtttcttgtatg |
210 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1584983 |
atttttgcgccactaacaaatttggcatgcttagtggggcaatatgaactttaccactgaaaaatctagtacaccaagtcaagactaagtttcttgtatg |
1585082 |
T |
 |
| Q |
211 |
cacctgaggtctaaaaagagtctcagcagtatgaaacaaatgtgatatt |
259 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1585083 |
cacctgaggtctgaaaagagtctcaacagtatgaaacaaatgtgatatt |
1585131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University