View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2742_low_35 (Length: 249)
Name: NF2742_low_35
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2742_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 29 - 203
Target Start/End: Original strand, 32782303 - 32782477
Alignment:
| Q |
29 |
gaaaccaaaccgtttgtttgagacgtttggctctacggcggaaggaacggaagaggagaacggagatagcaccagtgaggagaacactagcagcaatttg |
128 |
Q |
| |
|
|||| ||||||||||||||||||||||| || || ||||||||||| ||||||||||| |||||||||||||| |||||||||| ||| ||||| ||||| |
|
|
| T |
32782303 |
gaaagcaaaccgtttgtttgagacgtttagccctgcggcggaaggagcggaagaggaggacggagatagcaccggtgaggagaagactggcagcgatttg |
32782402 |
T |
|
| Q |
129 |
tatgaaagaaggatcttcagtggaggagagaagagaaggagtagaatcatatgggatttgaatgggtccatctgt |
203 |
Q |
| |
|
||||||||||| || |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32782403 |
gatgaaagaagggtcgtcagtggaagagagaagagaaggagtagaatcatatgggatttcaatgggtccatctgt |
32782477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University