View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2742_low_37 (Length: 236)
Name: NF2742_low_37
Description: NF2742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2742_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 10384119 - 10383899
Alignment:
| Q |
1 |
ccttggatttcatgaaacattggagattgaacaaatttttgtatacaagctcaaatgttgaagaatccatgtgtgcaactgtttcaaaaaatcaagatat |
100 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10384119 |
ccttggaattcatgaagcattggagattgaagaaatttttgtatacaagctcaaatgttgaagaatccttgtgtgcaactgtttcaaaaaatcaagatat |
10384020 |
T |
|
| Q |
101 |
agctgaatcatatggcttctttgttaatgaaatagatacaaatcactttggtggattttgtcaggtaaataatcatatgtttgaaacagcttataccatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10384019 |
agctgaatcatatggcttctttgttaatgaaatggatacaaatcactttggtggattttgtcaggtaaataatcatatgttcgaaacagcttataccatc |
10383920 |
T |
|
| Q |
201 |
catgctaactgctgtgaagat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10383919 |
catgctaactgctgtgaagat |
10383899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 132 - 217
Target Start/End: Complemental strand, 10380802 - 10380717
Alignment:
| Q |
132 |
atagatacaaatcactttggtggattttgtcaggtaaataatcatatgtttgaaacagcttataccatccatgctaactgctgtga |
217 |
Q |
| |
|
||||||| |||||| ||||| ||||| |||||| | ||||| ||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
10380802 |
atagatagaaatcagtttggcggattctgtcagcttaataacgatatgtttgaaacagtgtataccatccatgctaactgttgtga |
10380717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University