View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2743_low_17 (Length: 235)
Name: NF2743_low_17
Description: NF2743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2743_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 38 - 186
Target Start/End: Complemental strand, 34822109 - 34821961
Alignment:
| Q |
38 |
atccagttaagaggagagaacacacgttatgcgtcttgtaggttctgcgatggagattagttattattaaatggtggtggaaactttgtattaattataa |
137 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
34822109 |
atccagctaagaggagagaacacatgttatgcgtcttgcaggttctgcgatggagattagttattgttaaatggtggtggaagctttgtatcaattataa |
34822010 |
T |
|
| Q |
138 |
ggtaaaacaagaaaagatatcaaatagataaaatgattcacatgataat |
186 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34822009 |
ggtaaaacaagaaaagatatcaaatggataaaatgattcacatgataat |
34821961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University