View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2743_low_18 (Length: 227)
Name: NF2743_low_18
Description: NF2743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2743_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 62 - 178
Target Start/End: Complemental strand, 19738709 - 19738593
Alignment:
| Q |
62 |
cccctaaatcgttcattccaaagagaggcttagagtgtctctagactataatgtttctcatacttattttttaaaccgacgaaatccacgtcaatttcat |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19738709 |
cccctaaatcgttcattccaaacagaggtttagagtgtctctagactctaatgtttctcatacttattttttaaactgacgaaatccacgtcaatttcat |
19738610 |
T |
 |
| Q |
162 |
ttaatcatataacgagt |
178 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
19738609 |
ttaatcatataacgagt |
19738593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University