View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2743_low_21 (Length: 204)

Name: NF2743_low_21
Description: NF2743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2743_low_21
NF2743_low_21
[»] chr4 (1 HSPs)
chr4 (23-170)||(25272874-25273022)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 23 - 170
Target Start/End: Original strand, 25272874 - 25273022
Alignment:
23 gatcacatat-atatataaaatcacaaaaccatcatcagtagcttctcccttcaaaaagtagcttctatgnnnnnnnagcttctctannnnnnnaggagt 121  Q
    |||||||||| ||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||       ||||||    
25272874 gatcacatattatatatgtaatcacaaaaccatcatcagtagcttctcccttcaaaaagtagcttctatgtttttttagcttctctatttttttaggagt 25272973  T
122 ctctaccttctctattgtttaaaattctcagtctctcccacaaatacaa 170  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
25272974 ctctaccttctctattgtttaaaattctcagtctctcccacaaatacaa 25273022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University