View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2743_low_21 (Length: 204)
Name: NF2743_low_21
Description: NF2743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2743_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 23 - 170
Target Start/End: Original strand, 25272874 - 25273022
Alignment:
| Q |
23 |
gatcacatat-atatataaaatcacaaaaccatcatcagtagcttctcccttcaaaaagtagcttctatgnnnnnnnagcttctctannnnnnnaggagt |
121 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
25272874 |
gatcacatattatatatgtaatcacaaaaccatcatcagtagcttctcccttcaaaaagtagcttctatgtttttttagcttctctatttttttaggagt |
25272973 |
T |
 |
| Q |
122 |
ctctaccttctctattgtttaaaattctcagtctctcccacaaatacaa |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25272974 |
ctctaccttctctattgtttaaaattctcagtctctcccacaaatacaa |
25273022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University