View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2743_low_8 (Length: 308)
Name: NF2743_low_8
Description: NF2743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2743_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 294
Target Start/End: Complemental strand, 6028178 - 6027901
Alignment:
| Q |
17 |
caaaggctttggtgctggcattgcggttaggctttttcagctnnnnnnngtaaagttatggaggatttcatgttaggttttttccaaattcatctaaaag |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6028178 |
caaaggctttggtgctggcattacggttaggctttttcagctaaaaaaagtaaagttatggaggatttcatgttaggttttttccaaattcatctaaaag |
6028079 |
T |
|
| Q |
117 |
aggaatgtaactgtctcttgatttcattcttttaccttcccttttctagtagttatagccattcaccattaacaattttgtgattcactcacacttcaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6028078 |
aggaatgtaactgtctcttgatttcattcttttaccttcccttttctagtagttatagccattcaccattaacaattttgtgattcactcacacttcaca |
6027979 |
T |
|
| Q |
217 |
gtgaattagggcacagtgtggtaggtataatctatagcatgataagagaattttatgtactcttacatcttaattgat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027978 |
gtgaattagggcacagtgtggtaggtataatctatagcatcataagagaattttatgtactcttacatcttaattgat |
6027901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University