View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2744_low_8 (Length: 275)
Name: NF2744_low_8
Description: NF2744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2744_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 53098584 - 53098374
Alignment:
| Q |
18 |
ttttcatttctcctcttaatcataaatagataaatatcatcaatcgagaaagagaacnnnnnnnnntaaaatacaaaactgtggaattggaatggatgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53098584 |
ttttcatttctcctcttaatcataaatagataaatatcatcaatcgagaaagagaacaaa-------aaaatacaaaactgtggaattggaatggatgag |
53098492 |
T |
 |
| Q |
118 |
acgaagaaggttattattatctaatggataaaactgtgatgaagaagaagaagaagcgtggtggtgacacaaaacaacaacaacaatctggtattttatt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53098491 |
acgaagaaggttattattatcaaatggataaaactgtgatgaa---------gaagcgtggtggtgacacaa---aacaacaacaatctggtattttatt |
53098404 |
T |
 |
| Q |
218 |
ctaaccctctttcccttgtcgctttcttct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53098403 |
ctaaccctctttcccttgtcgctttcttct |
53098374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University