View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_high_30 (Length: 253)
Name: NF2746_high_30
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 15 - 154
Target Start/End: Original strand, 12867758 - 12867899
Alignment:
| Q |
15 |
agcaaaggtattgggaaacttgtagagcaaggcaagatagaactcatcgaaggaacaaggagcatacatgtcccttctcatactctctatgctga--aga |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12867758 |
agcaaaggcattgggaaacttgtagagcaaggcaagatagaacttatcgaaggaacaaggagcatacatgtcccttctcatactctctatgctgatgaga |
12867857 |
T |
 |
| Q |
113 |
taatggtgttttctaatggtgttttgtgagtgcctatgtttc |
154 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12867858 |
taatggtgttttgtaatggtgttttgtgagtgcctatgtttc |
12867899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University