View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_high_33 (Length: 249)
Name: NF2746_high_33
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 27 - 237
Target Start/End: Complemental strand, 9664849 - 9664638
Alignment:
| Q |
27 |
gtgcatataacatttttcttttgctatattagtgcatatataatgcgaaattgattgtgttgcataataagtaataataagagtatgtggatggtgaatg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9664849 |
gtgcatataacatttttcttttgctatattagtgcatatataatgcgaaattgattgggttgcataataagtaataataagagtatgtggatggtgaatg |
9664750 |
T |
 |
| Q |
127 |
tccgatagtgaaaagaggctaggaagatg--ctctctctttagtagtttttgagattttaactgaaacaaaatttgtagnnnnnnnnnaatgtgtgtatc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9664749 |
tccgatagtgaaaagaggctaggaagatggcctctctctttagtagtttttgagattttaactgaaacaaaatttgtag-ttttttttaatgtgtgtatc |
9664651 |
T |
 |
| Q |
225 |
ctcattttatttt |
237 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9664650 |
ctcattttatttt |
9664638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University