View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_high_40 (Length: 239)
Name: NF2746_high_40
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_high_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 77 - 221
Target Start/End: Complemental strand, 10265249 - 10265105
Alignment:
| Q |
77 |
atgaatccataggaaattccgcaggtatttctgcagatttccctgcaaattttattgtctcccttttatgatttcggaagttccacatgagttgattgag |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||| || |||||||||||| |
|
|
| T |
10265249 |
atgaatccataggaaattccgcaggtatttctgcagatttccctgcaaatttcgttgtctcccctttatgatttctgaagttccccacgagttgattgag |
10265150 |
T |
 |
| Q |
177 |
cttttacaaaatacaacacaattatgctttggtaaaagttcgctt |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
10265149 |
cttttacaaaatacagcacaattatgctttggtaaaagtttgctt |
10265105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10265324 - 10265278
Alignment:
| Q |
1 |
atccgcaggcaacaaatacatttgctggggtatctcctgcggaagtg |
47 |
Q |
| |
|
||||| |||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
10265324 |
atccgtaggcaagaaatacatttgccggggtttctcctgcggaagtg |
10265278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 140 - 203
Target Start/End: Original strand, 30245666 - 30245729
Alignment:
| Q |
140 |
ttttatgatttcggaagttccacatgagttgattgagcttttacaaaatacaacacaattatgc |
203 |
Q |
| |
|
||||| |||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30245666 |
ttttacgatttctgaagttccccatgagttgattgagcttctacaaaatacaacacaattatgc |
30245729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 140 - 202
Target Start/End: Original strand, 20301053 - 20301115
Alignment:
| Q |
140 |
ttttatgatttcggaagttccacatgagttgattgagcttttacaaaatacaacacaattatg |
202 |
Q |
| |
|
|||||||||| | |||||||| ||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
20301053 |
ttttatgattgctgaagttccccatgagttggttgagcttctacaaaatacaacataattatg |
20301115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 77 - 118
Target Start/End: Complemental strand, 20121296 - 20121255
Alignment:
| Q |
77 |
atgaatccataggaaattccgcaggtatttctgcagatttcc |
118 |
Q |
| |
|
|||||||| ||||||||||||| |||||| |||||||||||| |
|
|
| T |
20121296 |
atgaatccttaggaaattccgccggtattcctgcagatttcc |
20121255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University