View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_high_47 (Length: 227)
Name: NF2746_high_47
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 163190 - 162968
Alignment:
| Q |
1 |
caccaatcttcttactgatttgcaaatatcaacggctcatgctcctaaagtcttgactgatgagtaacatacaatagcttactatgagttccgtgaagtc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
163190 |
caccaatcttcttacttatttgcaaatatcaacggctcatgctcctaaagtcttgactgatgagtaacatacaatagcttactataagttccgtgaagtc |
163091 |
T |
|
| Q |
101 |
ttacacacaagactcaaaagcaaacaataccgcagaaatgtggcttgaggtcgaaacac--tgtatagaatatagagtaacagttctttacagttaacta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
163090 |
ttacacacaagactcaaaagcaaacaataccgcagaaatgtggcttgaggtcgaaacactgtgtatagaatatagagtaacagttctttacagttaacta |
162991 |
T |
|
| Q |
199 |
gtattagtctagtcagcttaatt |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
162990 |
gtattagtctagtcagcttaatt |
162968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University