View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_14 (Length: 358)
Name: NF2746_low_14
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 11 - 313
Target Start/End: Original strand, 36686237 - 36686539
Alignment:
| Q |
11 |
cacagaccgttcagcgagtgcttacctttggtcttgcttcttgtagaggtaattttagagatattttagttcattttgttggttgctttgttgttcttct |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36686237 |
cacagacggttcagcgagtgcttacctttggtcttgcttcttgtagaggtaattttagagatattttagttcattttgttggttgctttgttgttcttct |
36686336 |
T |
 |
| Q |
111 |
tgaccgtgttttcaaactctattgttgacccgtaatctcgtctaaatttacgtttttaggtttgtgtttggtgttgatttcatgataaacttgttttata |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
36686337 |
tgaccgtgttttcaaactctattgttgacccgtaatctcgtctaaatttacgtttttaggtttgtgtttagtgttgatttgatgataaacttgttttata |
36686436 |
T |
 |
| Q |
211 |
gtgaaatcgaagctggcaccgaatttgaccgattcaactagcgacaaaattgaagaaatcggataaactcgtctgattttaagcgaatttgcgattttcc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36686437 |
gtgaaatcgaagctggcaccgaatttgaccgattcaactagcgacaaaattgaggaaatcggattaactcgtctgattttaagcgaatttgcgattttcc |
36686536 |
T |
 |
| Q |
311 |
att |
313 |
Q |
| |
|
||| |
|
|
| T |
36686537 |
att |
36686539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University