View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_21 (Length: 303)
Name: NF2746_low_21
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 23589120 - 23589404
Alignment:
| Q |
1 |
tatatgtatttgttttgatttaggtaatgtagggaactcttatgtcatcagtgtacttctttcacttttaatgttaatcatggtttaagcttctattcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23589120 |
tatatgtatttgttttgatttaggtaatgtagggaactcttatgtcatcagtgtacttctttcacttttaatgttaatcatggtttaagcttctattcta |
23589219 |
T |
|
| Q |
101 |
cattttacttagtttgattaattgcttattgttctcaaactaaattctgttattcttcgttgcatttgctgtgtttatcaggatgaaatggttactcttt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23589220 |
cattttgcttagtttgattaattgcttattgttctcaaactaaattgtgttattcttcgttgcatttgctgtgtttatcaggatgaaa-ggttactcttt |
23589318 |
T |
|
| Q |
201 |
gctggaaatttaatcaggtaagaaatttgcaggtaggaaaacccttcaattttggtgtttgtttgtagttgataattggtgcaatt |
286 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23589319 |
gctgaaaatttaatcaggtaagaaatttgcaggtaggaaaacccttcaattttggtgtttgtttgaagttgataattggtgcaatt |
23589404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University