View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2746_low_25 (Length: 290)

Name: NF2746_low_25
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2746_low_25
NF2746_low_25
[»] chr7 (3 HSPs)
chr7 (1-94)||(44350395-44350488)
chr7 (197-290)||(44350055-44350149)
chr7 (129-193)||(44350296-44350360)


Alignment Details
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 44350488 - 44350395
Alignment:
1 agataaatttaatgttatactaaattttttatttcgttgattttgtaagaaaaatatccaaaaattgataaactatatttttatttctgcgatt 94  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
44350488 agataaatttaatgttatactaaattttttatttcgttgatgttgtaagaaaaatatccaaaaattgataaactatatttttatttctgcgatt 44350395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 197 - 290
Target Start/End: Complemental strand, 44350149 - 44350055
Alignment:
197 ccaacgaaaaatctagtgtgtcagctt-ggctctgatcttattgcacttagtcaaccctgtaaaacaaatatgggagatcgagatctagaatgat 290  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44350149 ccaacgaaaaatctagtgtgtcagctttggctctgatcttattgcacttagtcaaccctgtaaaacaaatatgggagatcgagatctagaatgat 44350055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 129 - 193
Target Start/End: Complemental strand, 44350360 - 44350296
Alignment:
129 gaattatgggaggaggagtagctttgtagtttgaggaaggttaggacactctcttttcaacactc 193  Q
    |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||    
44350360 gaattatgggaggaggagtagctttgtagtttgaggaaggctagaacactctcttttcaacactc 44350296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University