View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_25 (Length: 290)
Name: NF2746_low_25
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 44350488 - 44350395
Alignment:
| Q |
1 |
agataaatttaatgttatactaaattttttatttcgttgattttgtaagaaaaatatccaaaaattgataaactatatttttatttctgcgatt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44350488 |
agataaatttaatgttatactaaattttttatttcgttgatgttgtaagaaaaatatccaaaaattgataaactatatttttatttctgcgatt |
44350395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 197 - 290
Target Start/End: Complemental strand, 44350149 - 44350055
Alignment:
| Q |
197 |
ccaacgaaaaatctagtgtgtcagctt-ggctctgatcttattgcacttagtcaaccctgtaaaacaaatatgggagatcgagatctagaatgat |
290 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44350149 |
ccaacgaaaaatctagtgtgtcagctttggctctgatcttattgcacttagtcaaccctgtaaaacaaatatgggagatcgagatctagaatgat |
44350055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 129 - 193
Target Start/End: Complemental strand, 44350360 - 44350296
Alignment:
| Q |
129 |
gaattatgggaggaggagtagctttgtagtttgaggaaggttaggacactctcttttcaacactc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
44350360 |
gaattatgggaggaggagtagctttgtagtttgaggaaggctagaacactctcttttcaacactc |
44350296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University