View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_27 (Length: 276)
Name: NF2746_low_27
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 258
Target Start/End: Complemental strand, 17111149 - 17110909
Alignment:
| Q |
20 |
tatagattatagtatg-aattatatattgattgcttggttgtaagtgtaacacgcatatctcttgtaggtaccatcaatcgaacctaccaccaaataatg |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17111149 |
tatagattatagtatgcaattatatattgattgcttggttgtaagtgtaacacgcatatctcttgtaggtaccatcaatcgaacctaccaccaaataatg |
17111050 |
T |
 |
| Q |
119 |
catgcttccccagttcccctgaaaaa-cattaggaatatacatcttataataacatttttacgtgtatttatcaagaatcataatcttaatttagaccct |
217 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17111049 |
catgcttccccggttcccctgaaaaaaccttaggaatatacatcttataataacatttttacgtgtatttatcaagaatcataatcttaatttagaccct |
17110950 |
T |
 |
| Q |
218 |
ccgtcacggtaatggtactttgcattattgcttagcacttc |
258 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17110949 |
ccgtcacggtaatggcactttgcattattgcttagcacttc |
17110909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University