View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_31 (Length: 260)
Name: NF2746_low_31
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 37072174 - 37072397
Alignment:
| Q |
16 |
ggtaagacgattgcacctggcaatactgaaactagacttgtgttgttgaaggattcactagcacatagttcgacatttagtgtttggggaaaataaacca |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37072174 |
ggtaagacgattgcacctggcaatattgaaactagacttgtgttgttgaaggattcactagcacatagttcgacatttagtgtttggggaaaataaacca |
37072273 |
T |
 |
| Q |
116 |
tattaaagagaggaaaatagcaatcccttccctgcggttacaacttgagtcaggaatttataaattaatattaattttatagttacgagtgaaaaataca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37072274 |
tattaaagagaggaaaatagcaatcccttccctgcggttacaacttgagtcaggaatttataaattaatattaattttatagttacgagtgaaaaatac- |
37072372 |
T |
 |
| Q |
216 |
tagtataattagttgattcatagtt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37072373 |
tagtataattagttgattcatagtt |
37072397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University