View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_33 (Length: 251)
Name: NF2746_low_33
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_33 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 3646408 - 3646175
Alignment:
| Q |
18 |
ctctcttgatgatatcaactataattccaagcctaagtcctccaacatgcaaggaacatacaacttgtgtaaaagcaaacaatacacagttaacagttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3646408 |
ctctcttgatgatatcaactataattccaagcctaagtcctccaacatgcaaggaacatacaacttgtgtaaaagcaaacaatacacagttaacagttct |
3646309 |
T |
|
| Q |
118 |
gtttttagcgctttatgtcactgcacttggcacagggggtttaaaatccagtgtccctggctttggttcagatcaatttgatgctactgataaagaagag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3646308 |
gtttttagcgctttatgtcactgcacttggcacagggggtttaaaatccagtgtccctggctttggttcagatcaatttgatgctactgataaagaagag |
3646209 |
T |
|
| Q |
218 |
aagaaacatatggttaaatttctcaattggtatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3646208 |
aagaaacatatggttaaatttctcaattggtatt |
3646175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 200
Target Start/End: Complemental strand, 3658738 - 3658659
Alignment:
| Q |
121 |
tttagcgctttatgtcactgcacttggcacagggggtttaaaatccagtgtccctggctttggttcagatcaatttgatg |
200 |
Q |
| |
|
|||||| |||||| |||| || || ||||| || ||| ||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
3658738 |
tttagcactttatatcacagccctcggcactggcggtctaaaatctagtgtctctggctttggttccgatcaatttgatg |
3658659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University