View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_37 (Length: 247)
Name: NF2746_low_37
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 4 - 157
Target Start/End: Original strand, 5217998 - 5218151
Alignment:
| Q |
4 |
atgacacattaaccggatatgccacactgcacgataatatcatatcaatatcaactcattagggactaatttgcacataaaatttaaatgatttcatgga |
103 |
Q |
| |
|
|||||||||||||||||||||||||| | || || || |||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
5217998 |
atgacacattaaccggatatgccacattacaaaatgatctcatatcaatatcaactcattagggactaattcgcacataaaatttaaaaaatttcatgga |
5218097 |
T |
|
| Q |
104 |
catatttgtcattaattgcaattgtgaatggattaattatggggaaattaatcc |
157 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
5218098 |
catatttgtcaataattgcaactttgaatggattaattatggggaaattaatcc |
5218151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University