View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_41 (Length: 241)
Name: NF2746_low_41
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 45202910 - 45202689
Alignment:
| Q |
1 |
ccaaggatgacttgcccggctaaaaaccattacatgggacctgatgagtatgtcccttgtttagttttccggcaggcgggttatcctaggctttttgact |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45202910 |
ccaaggatgacttgcctggctaaaaaccattacatgggacctgatgagtatgtcccttgtttagttttccggcaggcgggttatcctaggctttttgact |
45202811 |
T |
 |
| Q |
101 |
gtctcttatcttacatgctagaccttcactcttcccatatcatatcaaggttcttaatcttactactatctatgatgaatcaccatgatagtaaatgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45202810 |
gtctcttatcttacatgctagaccttcactcttcccatatcatatcaaggttcttaatcttactactatctatgatgaatcaccatgatagtaaatgcta |
45202711 |
T |
 |
| Q |
201 |
ttcttaattacaggaaaatgtt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45202710 |
ttcttaattacaggaaaatgtt |
45202689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 42 - 145
Target Start/End: Original strand, 45212337 - 45212439
Alignment:
| Q |
42 |
tgatgagtatgtcccttgtttagttttccggcaggcgggttatcctaggctttttgactgtctcttatcttacatgctagaccttcactcttcccatatc |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45212337 |
tgatgagtatgtcccttgtttagtttattagcaggcaggt-atcctaggctttttgactgtctcttatcttacatgctagaccttcactcttcaaatatc |
45212435 |
T |
 |
| Q |
142 |
atat |
145 |
Q |
| |
|
|||| |
|
|
| T |
45212436 |
atat |
45212439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 148
Target Start/End: Complemental strand, 45206312 - 45206259
Alignment:
| Q |
95 |
ttgactgtctcttatcttacatgctagaccttcactcttcccatatcatatcaa |
148 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45206312 |
ttgactgtctcttgtcttacatgctagaccttcactcttttcatatcatatcaa |
45206259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University