View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_55 (Length: 210)
Name: NF2746_low_55
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 42 - 195
Target Start/End: Complemental strand, 43797275 - 43797122
Alignment:
| Q |
42 |
atgaataatacttactctatttcttaagaaatcatcacgggtaaaatttagaataaggtaaaagaagctaattacatgcacagaacataaattttaagca |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43797275 |
atgaataatacttactctatttcttaagaaatcatcacgggtaaaatttagaataaggtaaaagaagctaattacatgcacagaacagaaattttaagca |
43797176 |
T |
|
| Q |
142 |
tctaaataaaacatcaacaactgaacaaatgtaaaaattaatatagattataat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797175 |
tctaaataaaacatcaacaactgaacaaatgtaaaaattaatatagattataat |
43797122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University