View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_56 (Length: 206)
Name: NF2746_low_56
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_56 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 12867573 - 12867778
Alignment:
| Q |
1 |
ataaaagtgttgaaaacttttggtgtcgacaataaattctgcgattagattcaagtcattatggaatcggcttctctttcaatttatgtcaatgacactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12867573 |
ataaaagtgttgaaaacttttggtgtcaacaataaattctgcgattagattcaagtcattatggaatcggcttctctttcaatttatgtcaatgacactc |
12867672 |
T |
|
| Q |
101 |
aacatggatatttcaagtgcaagaaaggagtgcgacatggtgttccattatcccccctcctttgttgcagt-ttgaagatgtctgaagcaaaggtattgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
12867673 |
aacatggatatttcaagtgcaagaaaggagtgcgacatggtgatccattat-ccccctccttttttgcagtgttgaagatgtcttaagcaaaggcattgg |
12867771 |
T |
|
| Q |
200 |
gaaactt |
206 |
Q |
| |
|
||||||| |
|
|
| T |
12867772 |
gaaactt |
12867778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University