View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2746_low_57 (Length: 205)
Name: NF2746_low_57
Description: NF2746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2746_low_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 22073791 - 22073616
Alignment:
| Q |
18 |
cacttgctgcatccaaaaaagtttgtgttcattctcctcaactgcccaatccaaaacaatttgatggaagcagaatccaaccagaggtcgcggttctaag |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22073791 |
cacttgctgcatcaaaaaaagtttgtgttcattctcctcaactgcccaatccaaaacaatttaatggaagcagaatccaaccagaggtcgcagttctaag |
22073692 |
T |
|
| Q |
118 |
cagagaaaaaagaaatataattattcaaaataacaagttacatgtgccattaacaggtcatgccgaatcttcatct |
193 |
Q |
| |
|
||||||||||||||| | |||| | ||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
22073691 |
cagagaaaaaagaaaaagaattttgcaaaataacaagttagatgtgccattaacaggtcatgctgaatcttcatct |
22073616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University