View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_high_20 (Length: 366)
Name: NF2747_high_20
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 16 - 352
Target Start/End: Original strand, 36395099 - 36395435
Alignment:
| Q |
16 |
caatgagaaggatatttatggttttataacagtgtatttgtaactatgtatgaaatggcgtcacatagagtcaataacggggacttatacctcatgtata |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36395099 |
caatgagaaagatatttatggttttataacagtgtatttgtaactatgtatgaaatggcgtcacatagagtcaataacggggacttatacctcatgtata |
36395198 |
T |
|
| Q |
116 |
atggtgtgattatgtacaaataagtgatatctaatgacccttttcaagttacaaatgtcttgtaacttaactataaatttctctgcaaattgaccgatgt |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36395199 |
atggtgtgattatgtacaaataagtaatatctaatgacccttttcaggttacagatgtcttgtaacttaactataaatttctctgcaaattgaccgatgt |
36395298 |
T |
|
| Q |
216 |
ttgatggtggtgttattatttggttgttgttggttatttaactacttgtatagtaggtgaaacaatgatcccaatttgctaatttgcaatcctcttttgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36395299 |
ttgatggtggtgttattatttggttgttgttggttatttaactacttgtatagtaggtgaaacaatgatcccaatttgctaatttgcaatcctcttttgt |
36395398 |
T |
|
| Q |
316 |
ctgttgttacactttgaattgtatctcccagtattat |
352 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
36395399 |
ctgctgttacactttgaattgtatctcccagttttat |
36395435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 277 - 341
Target Start/End: Original strand, 50508768 - 50508832
Alignment:
| Q |
277 |
acaatgatcccaatttgctaatttgcaatcctcttttgtctgttgttacactttgaattgtatct |
341 |
Q |
| |
|
||||| ||| |||||| |||||||| ||| |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
50508768 |
acaataatcacaatttactaatttgaaattctcttttgtctgatgtgacactttgaattgtatct |
50508832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University