View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_high_29 (Length: 312)
Name: NF2747_high_29
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_high_29 |
 |  |
|
| [»] chr3 (32 HSPs) |
 |  |
|
| [»] scaffold0576 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0217 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold1175 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 32)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 22 - 312
Target Start/End: Complemental strand, 45272471 - 45272182
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttcnnnnnnnnn---tgtgaggcaatgtgatgcataagtaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45272471 |
ggcggtgggattggtcccctcggattagttgact----cttggatcggataccgagttttcaaaaaaaaaaagtgtgaggcaatgtgatgcataagtaaa |
45272376 |
T |
 |
| Q |
119 |
agacatttcaccttataaaccagttttgtatgattgagttagacgcaattctaaatattcaaaacaataatatacattatcaagattttgatctcaatta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45272375 |
agacatttcaccttataaaccagttttgtatgattgagttagacgcaattctaaatattcaaaacaataatatacattatcaagattttgatctcaatta |
45272276 |
T |
 |
| Q |
219 |
gtctctattatttgattattcaggttgttgaaatcgaaacagctcctaagaaaaaaggacatcataagagaaggaaattggtggcgatgaagaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45272275 |
gtctctattatttgattattcaggttgttgaaatcgaaacagctcctaagaaaaaaggacatcataagagaaggaaattggtggcgatgaagaa |
45272182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 4048094 - 4048147
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4048094 |
cggtgggattggtcccctcggattagttg----attcttggatcggataccgagtttt |
4048147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 8097334 - 8097278
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
8097334 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
8097278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 26174255 - 26174311
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
26174255 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
26174311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 53848489 - 53848433
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
53848489 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
53848433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 24407403 - 24407458
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
24407403 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
24407458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 49258317 - 49258262
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
49258317 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
49258262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 52821691 - 52821636
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
52821691 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
52821636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 53424231 - 53424176
Alignment:
| Q |
23 |
gcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
53424231 |
gcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
53424176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 10083872 - 10083818
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
10083872 |
cggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
10083818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 10190795 - 10190741
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
10190795 |
cggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
10190741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 15566555 - 15566499
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
15566555 |
ggcggtgggattggtcccctcagattagtcgatt----cttggatcggataccgagttttc |
15566499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 24165770 - 24165714
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
24165770 |
ggcggtgggattgttcccctcggattagtcgatt----cttggatcggataccgagttttc |
24165714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 40133504 - 40133448
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40133504 |
ggcggtgggattggtcccctcgaattagtcgatt----cttggatcggataccgagttttc |
40133448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 25379903 - 25379957
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
25379903 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggatactgagttt |
25379957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 82
Target Start/End: Original strand, 3747730 - 3747779
Alignment:
| Q |
29 |
ggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
3747730 |
ggattggtcccctcggattagtcgatt----cttggatcggataccgagttttc |
3747779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 82
Target Start/End: Complemental strand, 52455701 - 52455648
Alignment:
| Q |
25 |
ggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
52455701 |
ggtgggattggtcccctcggattagtcg----attcttggattggataccgagttttc |
52455648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 8456201 - 8456149
Alignment:
| Q |
26 |
gtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
8456201 |
gtgggattggtcccctcggattagtcg----attcttgaatcggataccgagttttc |
8456149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 30257766 - 30257822
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||| |||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
30257766 |
ggcggtggcattggtcccctcggattagtcg----attcttggatcggataccgaattttc |
30257822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 81
Target Start/End: Complemental strand, 39041904 - 39041852
Alignment:
| Q |
25 |
ggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
39041904 |
ggtgggattggtccactcggattagtcgatt----cttggatcggataccgagtttt |
39041852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 45529809 - 45529754
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
45529809 |
ggcggtgggattggtcccctcggattagtcg----attctt-gatcggataccgagttttc |
45529754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 46576490 - 46576546
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||| ||||||||||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
46576490 |
ggcggtcggattggtccccttggattagtcgatt----cttggatcggataccgagttttc |
46576546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 48977530 - 48977586
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
48977530 |
ggcggtgggattggtcccctcggattagtcg----gtccttggatcggataccgagttttc |
48977586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 53233965 - 53233910
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
53233965 |
ggcggtgggattggtcccctcggattagtcg----attctt-gatcggataccgagttttc |
53233910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 18176942 - 18176887
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||| |||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
18176942 |
ggcggtgggattggtcccatcggattagtcg----attcttggatcggatacagagtttt |
18176887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 21363085 - 21363140
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||| ||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
21363085 |
ggcggtgggattggttccctcggatta----atcgattcttggatcggataccgagtttt |
21363140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 32151566 - 32151621
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||| |||||||||||||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
32151566 |
ggcggtgagattggtcccctcgaattagtcgatt----cttggatcggataccgagtttt |
32151621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 35493053 - 35493108
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||| | |||||||||||| |
|
|
| T |
35493053 |
ggcggtgggattggtcccctcggattagtcg----attcttggattgaataccgagtttt |
35493108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 54475823 - 54475878
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||| |||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
54475823 |
ggcggtgggattggtccccttggattagtcg----attcttggatcagataccgagtttt |
54475878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 48105019 - 48105073
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
||||||| |||||||||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
48105019 |
ggcggtgagattggtcccttcggattagtcgatt----cttggatcggataccgagttt |
48105073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 7485583 - 7485531
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
7485583 |
cggtgggattggtccc-tcggattagtcgatt----cttggatcggataccgagtttt |
7485531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 50
Target Start/End: Complemental strand, 55371349 - 55371321
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55371349 |
ggcggtgggattggtcccctcggattagt |
55371321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0576 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0576
Description:
Target: scaffold0576; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 5137 - 5081
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
5137 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
5081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 16)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 2639466 - 2639410
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2639466 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
2639410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 4718791 - 4718847
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
4718791 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
4718847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 8765581 - 8765525
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
8765581 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
8765525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 21603376 - 21603431
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
21603376 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
21603431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 34237709 - 34237654
Alignment:
| Q |
23 |
gcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
34237709 |
gcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
34237654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 42643173 - 42643118
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
42643173 |
ggcggtgggattggtcccctcgcattagttg----attcttggatcggataccgagtttt |
42643118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 28193620 - 28193674
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
28193620 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttt |
28193674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 2618332 - 2618388
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
2618332 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggattccgagttttc |
2618388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 3734674 - 3734622
Alignment:
| Q |
26 |
gtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
3734674 |
gtgggattggtcccctcggattagtcgatt----cttggatcggataccgagttttc |
3734622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 32879425 - 32879481
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
32879425 |
ggcggtgggattggtcccctcggattagtcg----attcttggattggataccgagttttc |
32879481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 10292200 - 10292255
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
10292200 |
ggcggtgggattggtcccttcggattagttg----attcttggatcgaataccgagtttt |
10292255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 14633100 - 14633156
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
14633100 |
ggcggtgggattggtccccttggattagtcg----attcttggatcggataccaagttttc |
14633156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 25248493 - 25248547
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
25248493 |
ggcggtgggattggtcccctcggattagtcgatt-----tttgatcggataccgagtttt |
25248547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 39349402 - 39349458
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||| ||||||||||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
39349402 |
ggcggtgggattgatcccctcggattagtcg----attcttggatcggataccaagttttc |
39349458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 4698777 - 4698722
Alignment:
| Q |
23 |
gcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||| ||||| ||||||||||||||| |
|
|
| T |
4698777 |
gcggtgggattggtcccctcggattagtcg----attcatggattggataccgagttttc |
4698722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 27 - 82
Target Start/End: Original strand, 42328155 - 42328206
Alignment:
| Q |
27 |
tgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
42328155 |
tgggattggtcccctcgaattagtcgatt----cttggatcggataccgagttttc |
42328206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 20)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 2751417 - 2751473
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2751417 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
2751473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 21217888 - 21217832
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21217888 |
ggcggtgggattgatcccctcggattagttg----attcttggatcggataccgagttttc |
21217832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 22120034 - 22120090
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
22120034 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
22120090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 40542965 - 40542909
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40542965 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
40542909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 7275423 - 7275478
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
7275423 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
7275478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 31712957 - 31712902
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
31712957 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
31712902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 24 - 82
Target Start/End: Original strand, 16374142 - 16374196
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
16374142 |
cggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
16374196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 42913566 - 42913512
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
42913566 |
cggtgggattggtcccctcggattagttg----attcttagatcggataccgagttttc |
42913512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 654760 - 654704
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
654760 |
ggcggtgggattggtcccctcggattagtcg----gttcttggatcggataccgagttttc |
654704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 7175917 - 7175861
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||| |
|
|
| T |
7175917 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggatactgagttttc |
7175861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 11997995 - 11998051
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
11997995 |
ggcggtgggattggtcccctcgaattagtcg----attcttggatcggataccgagttttc |
11998051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 21835297 - 21835353
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
21835297 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggatatcgagttttc |
21835353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 27312298 - 27312354
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
27312298 |
ggcggtgggattggtcccctcagattagtcg----attcttggatcggataccgagttttc |
27312354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 3851903 - 3851958
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
3851903 |
ggcggtgggattgatcccctcggattagtcg----attcttggatcggataccgagtttt |
3851958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 17197005 - 17196950
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
17197005 |
ggcggtgggattggtcccctcgaattagtcg----attcttggatcggataccgagtttt |
17196950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 82
Target Start/End: Original strand, 23092244 - 23092298
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
23092244 |
cggtgggattggtcccctcggattagtcg----attcatggatcggataccgagttttc |
23092298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 22703632 - 22703688
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| ||||||||||| ||||||| |
|
|
| T |
22703632 |
ggcggtgggattggtcccctcggattagtcg----attctttgatcggatacccagttttc |
22703688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 28089973 - 28090021
Alignment:
| Q |
30 |
gattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
28089973 |
gattggtcccctcggattagtcgatt----cttggatcggataccgagttttc |
28090021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 82
Target Start/End: Original strand, 31197738 - 31197792
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||| ||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
31197738 |
cggtgggattggtcccctcagattagtcg----attcttggatcggatatcgagttttc |
31197792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 32849741 - 32849791
Alignment:
| Q |
26 |
gtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32849741 |
gtgggattggtcccctcagattagtcgatt----cttggatcggataccgagttt |
32849791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 18)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 3222691 - 3222635
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
3222691 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
3222635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 15360153 - 15360097
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
15360153 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
15360097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 34147488 - 34147544
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
34147488 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
34147544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 34160104 - 34160160
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
34160104 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
34160160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 654201 - 654146
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
654201 |
ggcggtgggattggtcccctcggattagtcgatta----ttggatcggataccgagtttt |
654146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 9239117 - 9239171
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
9239117 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttt |
9239171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 21148566 - 21148510
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
21148566 |
ggcggtgggattggtcccctcggattagtcg----attcttgaatcggataccgagttttc |
21148510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 28672209 - 28672264
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
28672209 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcagataccgagtttt |
28672264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 82
Target Start/End: Original strand, 1345079 - 1345133
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
1345079 |
cggtgggattggtccccttggattagtcgatt----cttggatcggataccgagttttc |
1345133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 9690691 - 9690638
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
9690691 |
cggtgggattggtcctctcggattagtcgatt----cttggatcggataccgagtttt |
9690638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 82
Target Start/End: Original strand, 14213027 - 14213080
Alignment:
| Q |
25 |
ggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
14213027 |
ggtgggattggtccactcggattagtcgatt----cttggatcggataccgagttttc |
14213080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 57
Target Start/End: Original strand, 12390567 - 12390602
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaa |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12390567 |
ggcggtgggattggtcccctcggattagtcgattaa |
12390602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 21982375 - 21982320
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
21982375 |
ggcggtgggattggtccc-tcggattagtcgatt----cttggatcggataccgagttttc |
21982320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 5360126 - 5360071
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||||| |||||| | |||||| |||||||||||||||||| |
|
|
| T |
5360126 |
ggcggtgggattggtcccctcgaattagtcg----attcttagatcggataccgagtttt |
5360071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 11449013 - 11449068
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| |||||||| |||||||| |
|
|
| T |
11449013 |
ggcggtgggattggtcccctcggattagtcg----attcttgaatcggatatcgagtttt |
11449068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 11841044 - 11841097
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||||| ||||||||||||||||||||| |
|
|
| T |
11841044 |
cggtgggattagtcccctcgaattagtcgatta----ttggatcggataccgagtttt |
11841097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 50
Target Start/End: Original strand, 32596218 - 32596246
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32596218 |
ggcggtgggattggtcccctcggattagt |
32596246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 50
Target Start/End: Original strand, 33499617 - 33499645
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33499617 |
ggcggtgggattggtcccctcggattagt |
33499645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 23)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 8484716 - 8484660
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
8484716 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
8484660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 18207349 - 18207405
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
18207349 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
18207405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 19456266 - 19456210
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
19456266 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
19456210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 27498786 - 27498730
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
27498786 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
27498730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 30485970 - 30486026
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30485970 |
ggcggtgggattggtcccctcggattagtc----aattcttggatcggataccgagttttc |
30486026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 37495196 - 37495252
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
37495196 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
37495252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 41351159 - 41351103
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
41351159 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
41351103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 19145467 - 19145412
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19145467 |
ggcggtgggattggtcccctcggattagttg----gttcttggatcggataccgagtttt |
19145412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 22693077 - 22693132
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
22693077 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
22693132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 7085681 - 7085625
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
7085681 |
ggcggtgggattggtcccctcggattagtcg----attcttgaatcggataccgagttttc |
7085625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 10631340 - 10631288
Alignment:
| Q |
26 |
gtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
10631340 |
gtgggattggtcccctcggattagtcgatt----cttggatcggataccgagttttc |
10631288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 25 - 81
Target Start/End: Complemental strand, 11926553 - 11926501
Alignment:
| Q |
25 |
ggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
11926553 |
ggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
11926501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 33709558 - 33709502
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
33709558 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgtgttttc |
33709502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 38631034 - 38630978
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
38631034 |
ggcggtgggattggtcccctcggatta----atcgattcttggatcggataccgagttttc |
38630978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 27487609 - 27487554
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
27487609 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggatacagagtttt |
27487554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 82
Target Start/End: Original strand, 38684350 - 38684405
Alignment:
| Q |
23 |
gcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
38684350 |
gcggtgggattggtcccctcggattagtcg----attcttggatcggataccgatttttc |
38684405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 9659364 - 9659311
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
9659364 |
cggtgggattggtcccttcggattagttg----attcttggatgggataccgagtttt |
9659311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 23270575 - 23270522
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
23270575 |
cggtgggattggtcccctcggattagttg----attcttggattggataccaagtttt |
23270522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 10869620 - 10869564
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
10869620 |
ggcggtgggattggtcccctcggattagtcg----gttcttggatcggataccaagttttc |
10869564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 15641160 - 15641105
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
15641160 |
ggcggtgggattggtcccctcggattagtcg----attctt-gatcggataccgagttttc |
15641105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 32059495 - 32059439
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
32059495 |
ggcggtgggattggtcccctcggattagtcg----gtccttggatcggataccgagttttc |
32059439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 35425155 - 35425211
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
35425155 |
ggcggtgggattggtcctctcggattagtcg----attcttggatcggataccgaattttc |
35425211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 34310286 - 34310339
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
34310286 |
cggtgggattggtcccctcgaatta----atcgattcttggatcggataccgagtttt |
34310339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 20)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 34844813 - 34844757
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
34844813 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
34844757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 40058907 - 40058851
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40058907 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
40058851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 52983761 - 52983815
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
52983761 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttt |
52983815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 23639768 - 23639821
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
23639768 |
cggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
23639821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 23645426 - 23645479
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
23645426 |
cggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
23645479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 19660587 - 19660531
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
19660587 |
ggcggtgggattgatcccctcggattagtcgatt----cttggatcggataccgagttttc |
19660531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 27528850 - 27528794
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
27528850 |
ggcggtgagattggtcccctcggattagtcgatt----cttggatcggataccgagttttc |
27528794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 32986339 - 32986395
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
32986339 |
ggcggtgggattggtcccctcggaatagtcg----attcttggatcggataccgagttttc |
32986395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 46714535 - 46714591
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
46714535 |
ggcggtgggattggtcccctcggattagtc----aattcttgaatcggataccgagttttc |
46714591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 9978564 - 9978509
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
9978564 |
ggcggtgggattggtcccatcggattagttg----attcttagatcggataccgagtttt |
9978509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 52494630 - 52494685
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
52494630 |
ggcggtgggattggtcccctcgaattagtcg----attcttggatcggataccgagtttt |
52494685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 5609255 - 5609201
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
5609255 |
cggtgggattgatcccctcggattagtcgatt----cttggatcggataccgagttttc |
5609201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 45787757 - 45787703
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45787757 |
cggtgggattggtcccctcgaattagtcgatt----cttggatcggataccgagttttc |
45787703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 81
Target Start/End: Original strand, 34723944 - 34723996
Alignment:
| Q |
25 |
ggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
34723944 |
ggtgggattggtcctctcggattagtcgatt----cttggatcggataccgagtttt |
34723996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 36131565 - 36131509
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| || |||| |||||||||||||| |
|
|
| T |
36131565 |
ggcggtgggattggtcccctcggattagtcgatta----ttagatcagataccgagttttc |
36131509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 44343656 - 44343712
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||| |||||| | ||||||| |||||||||||||||||| |
|
|
| T |
44343656 |
ggcggtgggattggtcccctcgaattagtcg----attcttgaatcggataccgagttttc |
44343712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 55
Target Start/End: Original strand, 4065002 - 4065035
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgatt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
4065002 |
ggcggtgggattggtcccctcggattagtcgatt |
4065035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 81
Target Start/End: Original strand, 35229311 - 35229365
Alignment:
| Q |
23 |
gcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||| |||||| | |||||||||||||||||||| |||| |
|
|
| T |
35229311 |
gcggtgggattggtcccctcgaattagtcg----attcttggatcggataccgaatttt |
35229365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 79
Target Start/End: Complemental strand, 20078039 - 20077986
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtt |
79 |
Q |
| |
|
|||||||||||| || ||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
20078039 |
ggcggtgggattagttccctcggattagtcgatt----cttggatcggataccgagtt |
20077986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 50
Target Start/End: Complemental strand, 54127397 - 54127369
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54127397 |
ggcggtgggattggtcccctcggattagt |
54127369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 18)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 2140541 - 2140485
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
2140541 |
ggcggtgggattggtcccctcggattagtcgatta----ttggatcggataccgagttttc |
2140485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 44946108 - 44946052
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
44946108 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
44946052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 11941265 - 11941210
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
11941265 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
11941210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 15038101 - 15038157
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
15038101 |
ggcggtgggattggtcccctcagattagtcg----attcttggatcggataccgagttttc |
15038157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 18692102 - 18692158
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
18692102 |
ggcggtgggattggtcccctcgtattagtcg----attcttggatcggataccgagttttc |
18692158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 28669015 - 28669071
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
28669015 |
ggcggtgggattggtcccctcggattagtcgattt----ttggatcggataccgagttttc |
28669071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 33827628 - 33827572
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
33827628 |
ggcggtgggattggtccccttggattagtcgatt----cttggatcggataccgagttttc |
33827572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 34516469 - 34516413
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
34516469 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccaagttttc |
34516413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 35171942 - 35171998
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
35171942 |
ggcggtgggattggtcccctcggattagtcg----attcttgaatcggataccgagttttc |
35171998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 25293301 - 25293356
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||| |||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
25293301 |
ggcgatgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
25293356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 43374384 - 43374329
Alignment:
| Q |
23 |
gcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
43374384 |
gcggtgggattggtcccttcggattagtcgatt----cttggatcggataccgagttttc |
43374329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 14486967 - 14487023
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
14486967 |
ggcggtgggattggtcccctcggattagtcg----gtccttggatcggataccgagttttc |
14487023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 18976510 - 18976454
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||||| |||||| | |||||||||||||||||||| ||||| |
|
|
| T |
18976510 |
ggcggtgggattggtcccctcgaattagtcg----attcttggatcggataccgaattttc |
18976454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 19054168 - 19054224
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||| ||||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
19054168 |
ggcggtgggattggtccgctcggattagtcg----attcttggatcagataccgagttttc |
19054224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 27269399 - 27269344
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||| ||||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
27269399 |
ggcggtgggattgatcccctcggattagtcg----attcttggataggataccgagtttt |
27269344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 81
Target Start/End: Complemental strand, 30466881 - 30466830
Alignment:
| Q |
26 |
gtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
30466881 |
gtgggattggtcccttcggattagtcgatt----cttggatcggataccgagtttt |
30466830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 55
Target Start/End: Original strand, 24196144 - 24196177
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgatt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
24196144 |
ggcggtgggattggtcccctcggattagtcgatt |
24196177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 44929899 - 44929846
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||| | |||||| |||| |||||||||||||||||||||| |
|
|
| T |
44929899 |
cggtgggattggtccccttgaattagtcgatt----cttggatcggataccgagtttt |
44929846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 17)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 4621292 - 4621236
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
4621292 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagttttc |
4621236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 24122165 - 24122220
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
24122165 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccgagtttt |
24122220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 27454919 - 27454863
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
27454919 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggatacctagttttc |
27454863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 82
Target Start/End: Original strand, 7578554 - 7578607
Alignment:
| Q |
25 |
ggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7578554 |
ggtgggattggttccctcggattagttgattt----ttggatcggataccgagttttc |
7578607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 7766782 - 7766726
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| |||||||| ||||||||| |
|
|
| T |
7766782 |
ggcggtgggattggtcccctcggattagtcg----attcttgaatcggatatcgagttttc |
7766726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 15059457 - 15059401
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||| |||||||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
15059457 |
ggcggtgagattggtcccctcgaattagtcgatt----cttggatcggataccgagttttc |
15059401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 24 - 80
Target Start/End: Original strand, 34778483 - 34778535
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
|||||||||||||||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
34778483 |
cggtgggattggtccccttggattagtcg----attcttggatcggataccgagttt |
34778535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 45859091 - 45859043
Alignment:
| Q |
29 |
ggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
45859091 |
ggattggtcccctcggattagttgatta----ttggatcggataccgaatttt |
45859043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 7197302 - 7197247
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||| ||||||||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
7197302 |
ggcggtgagattggtcccctcggattagtcg----attcatggatcggataccgagtttt |
7197247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 55
Target Start/End: Complemental strand, 8779792 - 8779758
Alignment:
| Q |
21 |
aggcggtgggattggtcccctcggattagttgatt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
8779792 |
aggcggtgggattggtcccctcggattagtcgatt |
8779758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 14603947 - 14603994
Alignment:
| Q |
31 |
attggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
14603947 |
attggtcccctcggattagtcgatt----cttggatcggataccgagttttc |
14603994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 23041668 - 23041719
Alignment:
| Q |
26 |
gtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
23041668 |
gtgggattggtcccctcgaattagtcgatt----cttggatcggataccgagtttt |
23041719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 24674535 - 24674590
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||||| |||||| | |||||||||||||||||||| |||| |
|
|
| T |
24674535 |
ggcggtgggattggtcccctcgtattagtcg----attcttggatcggataccgaatttt |
24674590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 26513203 - 26513148
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||| |||||||||||||||||| | |||||||||||| |||||||||||| |
|
|
| T |
26513203 |
ggcggtgggaatggtcccctcggattagtcg----attcttggatcgaataccgagtttt |
26513148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 5315478 - 5315528
Alignment:
| Q |
27 |
tgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
|||||||||||||||||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
5315478 |
tgggattggtcccctcggataagtcgatt----cttggatcggataccgagtttt |
5315528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 17935911 - 17935965
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
17935911 |
ggcgatgggattggtccactcggattagtcgatt----cttggatcggataccgagttt |
17935965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 80
Target Start/End: Complemental strand, 37351508 - 37351454
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
37351508 |
ggcggtgggattggtcccctcggattagtcg----gtccttggatcggataccgagttt |
37351454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 39234 - 39290
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
39234 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcagataccgagttttc |
39290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 161951 - 162007
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
161951 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcagataccgagttttc |
162007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0217 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0217
Description:
Target: scaffold0217; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 7364 - 7309
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
7364 |
ggcggtgggattggtcccctcggattagtcg----attcttggatcggataccaagtttt |
7309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 13100 - 13047
Alignment:
| Q |
24 |
cggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
13100 |
cggtgggattgatcccctcagattagttgatt----cttggatcggataccgagtttt |
13047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 40467 - 40522
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagttttc |
82 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40467 |
ggcggtgggattggtccc-tcggattagtcgatt----cttggatcggataccgagttttc |
40522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 8506 - 8451
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
8506 |
ggcggtgggattggtccgctcggattagtcg----attcttagatcggataccgagtttt |
8451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 66896 - 66951
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagttgattaattcttggatcggataccgagtttt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
66896 |
ggcggtgggattggtcccctcggattagtcg----gtccttggatcggataccgagtttt |
66951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1175 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1175
Description:
Target: scaffold1175; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 50
Target Start/End: Complemental strand, 2481 - 2453
Alignment:
| Q |
22 |
ggcggtgggattggtcccctcggattagt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2481 |
ggcggtgggattggtcccctcggattagt |
2453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University