View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_high_35 (Length: 276)
Name: NF2747_high_35
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_high_35 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 161 - 276
Target Start/End: Original strand, 44688538 - 44688653
Alignment:
| Q |
161 |
tgggagctgatgccccgcatgtcaacacactttgtagacatatgtgtttttaaagagctgttttatatagtcaataaaattggtcggacatttgcttatg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44688538 |
tgggagctgatgccccgcatgtcaacacactttgtagacatatgtgtttttaaagagctgttttatatagtcaataaaattggtcggacatttgcttatg |
44688637 |
T |
|
| Q |
261 |
gagcagcggactttag |
276 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44688638 |
gagcagcggactttag |
44688653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 14 - 127
Target Start/End: Original strand, 44688424 - 44688537
Alignment:
| Q |
14 |
agggagctgtttagaataaggtagaagctgagaaaaaaggggcgaagaaaggttgctgctgtcacatgccatggaaataaacctgttgctctgtgccaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44688424 |
agggagctgtttagaataaggtagaagctgagaaaaaaggggcgaagaaaggttgctgctgtcacatgccatggaaataaacctgttgctctgtgcgaat |
44688523 |
T |
|
| Q |
114 |
tacatagtaacgga |
127 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44688524 |
tacatagtaacgga |
44688537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University