View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2747_high_47 (Length: 258)

Name: NF2747_high_47
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2747_high_47
NF2747_high_47
[»] chr1 (1 HSPs)
chr1 (15-114)||(724571-724672)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 15 - 114
Target Start/End: Original strand, 724571 - 724672
Alignment:
15 gaagaaagtgaatgaatgctttgagatgatttggttgacatgcatttcataaatatggaagcatgtaactatacatttcatagg--atggggtatttgat 112  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |  ||||||||||||||    
724571 gaagaaagtgaatgaatgctttcacatgatttggttgacatgcatttcagaaatatggaagcatgtaactatacatttcataagatatggggtatttgat 724670  T
113 tt 114  Q
    ||    
724671 tt 724672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University