View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_high_47 (Length: 258)
Name: NF2747_high_47
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 15 - 114
Target Start/End: Original strand, 724571 - 724672
Alignment:
| Q |
15 |
gaagaaagtgaatgaatgctttgagatgatttggttgacatgcatttcataaatatggaagcatgtaactatacatttcatagg--atggggtatttgat |
112 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
724571 |
gaagaaagtgaatgaatgctttcacatgatttggttgacatgcatttcagaaatatggaagcatgtaactatacatttcataagatatggggtatttgat |
724670 |
T |
 |
| Q |
113 |
tt |
114 |
Q |
| |
|
|| |
|
|
| T |
724671 |
tt |
724672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University