View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_high_48 (Length: 257)
Name: NF2747_high_48
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 143 - 235
Target Start/End: Complemental strand, 45342796 - 45342704
Alignment:
| Q |
143 |
ggtaatttacaagctctgtgtattgtctggtgtgaccattgtctgggatataaacggaaaaacaacaaccaaatagtataccatgccattgtt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342796 |
ggtaatttacaagctctgtgtattgtctggtgtgaccattgtctgggatataaacggaaaaacaacaaccaaatagtataccatgccattgtt |
45342704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 45342948 - 45342920
Alignment:
| Q |
1 |
tagggaaatcagaagcgtcgtctcagggt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45342948 |
tagggaaatcagaagcgtcgtctcagggt |
45342920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University