View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_high_61 (Length: 236)
Name: NF2747_high_61
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_high_61 |
 | |
|
| [»] scaffold0381 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 22789577 - 22789354
Alignment:
| Q |
1 |
actacgcttgagaatttggcagccccgtcttcggaccattatcccatccttttaaatagttgtcctgtgcaacggccttatttgcataaacgcagctttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22789577 |
actacgcttgagaatttggcagccccgtcttcggaccattatcccatccttttaaatagttgtcctgtgcaacggccttatttgcacaaacgcagctttc |
22789478 |
T |
|
| Q |
101 |
attatgagaatgcttggtacccggaaccaggtttcaaggagttcgtgactgatgcttggcatatgcattcac---attcaattgtctctaaattatcttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22789477 |
gttatgagaatgcttggtacccggaaccaggtttcaagaagttcgtgactgatgcttggcatatgcattcactagattcaattgtctctaaattatcttc |
22789378 |
T |
|
| Q |
198 |
ttgtgcggctgacatggtggtatg |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
22789377 |
ttgtgcggctgacatggtggtatg |
22789354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 10 - 218
Target Start/End: Complemental strand, 54565033 - 54564822
Alignment:
| Q |
10 |
gagaatttggcagccccgtcttcggaccattatcccatccttttaaatagttgtcctgtgcaacggccttatttgcataaacgcagctttcattatgaga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| | |||||||| ||||||||||| |||||| || ||||||||| ||||||| |||||||| |
|
|
| T |
54565033 |
gagaatttggcagccccgtcttcggaccactatcccattttgttaaatagatgtcctgtgcatcggcctcatatgcataaacatagctttcgttatgaga |
54564934 |
T |
|
| Q |
110 |
atgcttggtacccggaaccaggtttcaaggagttcgtgactgatgcttggcatatgcatt---cacattcaattgtctctaaattatcttcttgtgcggc |
206 |
Q |
| |
|
|||||||||||||| ||| ||| ||||| ||| | ||||||||||| ||||||||||||| || || || |||| |||||||||||||||||||||| |
|
|
| T |
54564933 |
atgcttggtacccgtaactaggcttcaaagagcttgtgactgatgcctggcatatgcattcaacaaatacagttgtacctaaattatcttcttgtgcggc |
54564834 |
T |
|
| Q |
207 |
tgacatggtggt |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
54564833 |
agacatggtggt |
54564822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 12530047 - 12529905
Alignment:
| Q |
19 |
gcagccccgtcttcggaccattatcccatccttttaaatagttgtcctgtgcaacggccttatttgcataaacgcagctttcattatgagaatgcttggt |
118 |
Q |
| |
|
||||| |||||||| || ||||||||||| ||||| ||||| | || | || || ||| || | |||||||| || |||| ||| ||||||| |||| |
|
|
| T |
12530047 |
gcagctccgtcttccgatcattatcccattcttttgaatagaagcccgttacagcgccctcatctccataaacgtagttttctttacgagaatgtgtggt |
12529948 |
T |
|
| Q |
119 |
acccggaaccaggtttcaaggagttcgtgactgatgcttggca |
161 |
Q |
| |
|
| ||||||||||||||||||| | |||||| |||||||||| |
|
|
| T |
12529947 |
attcggaaccaggtttcaaggaactagtgactaatgcttggca |
12529905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0381 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0381
Description:
Target: scaffold0381; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 161
Target Start/End: Original strand, 6662 - 6738
Alignment:
| Q |
85 |
cataaacgcagctttcattatgagaatgcttggtacccggaaccaggtttcaaggagttcgtgactgatgcttggca |
161 |
Q |
| |
|
|||||||| || |||| ||| |||||||| ||||| ||||||||||||||||||| | |||||| |||||||||| |
|
|
| T |
6662 |
cataaacgtagttttcgttacgagaatgcgtggtattcggaaccaggtttcaaggaactagtgactaatgcttggca |
6738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 161
Target Start/End: Complemental strand, 27013121 - 27013045
Alignment:
| Q |
85 |
cataaacgcagctttcattatgagaatgcttggtacccggaaccaggtttcaaggagttcgtgactgatgcttggca |
161 |
Q |
| |
|
|||||||| || |||| ||| |||||||| ||||| ||||||||||||||||||| | |||||| |||||||||| |
|
|
| T |
27013121 |
cataaacgtagttttcgttacgagaatgcgtggtattcggaaccaggtttcaaggaactagtgactaatgcttggca |
27013045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University