View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_high_63 (Length: 230)
Name: NF2747_high_63
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_high_63 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 26600309 - 26600088
Alignment:
| Q |
1 |
cgaactcactgtcaatccagacatgcatttagatcgatcgtttaacaatcatcgatatctatacataaaccctcatcagttaatggttttggtttacttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26600309 |
cgaactcactgtcaatccagacatgcatttagatcgatcgtttaacaatcatcgatatctatacataaaccctcatcggttaatggttttggtttacttt |
26600210 |
T |
|
| Q |
101 |
attgatcttcaagccaaaattctcccacaaatttccaccctcactgatcatgaaaggaaagcaagtatcaccattagcaacatttccaacattagaatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26600209 |
attgatcttcaagccaaaattctcccacaaatttccaccctcactaatcatgaaaggaaagcaagtatcaccattagcaacatttccaacattagaatca |
26600110 |
T |
|
| Q |
201 |
gaaggtgaagaaccatgatcat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26600109 |
gaaggtgaagaaccatgatcat |
26600088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University