View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_high_69 (Length: 203)
Name: NF2747_high_69
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_high_69 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 51 - 203
Target Start/End: Original strand, 6395986 - 6396140
Alignment:
| Q |
51 |
aaagaaattgtgtttgaatttccttaagccaagtcatgtcaattattgtaaatctgaataatttaattcttgagaaaaactactact--tataaatggga |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
6395986 |
aaagaaattgtgtttgaatttccttaagccaattcatgtcaattattgtaaatctgaataatttaattcttgagaaaaactactagttatataaatggga |
6396085 |
T |
 |
| Q |
149 |
gcatgaaatcattgtcaattgtgaaaagtctttgagatgaatgggaaaaacttat |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6396086 |
gcatgaaatcattgtcaactgtgaaaagtctttgagatgaatgggaaaaacttat |
6396140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 176
Target Start/End: Original strand, 6395950 - 6395989
Alignment:
| Q |
137 |
ttataaatgggagcatgaaatcattgtcaattgtgaaaag |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6395950 |
ttataaatgggagcatgaaatcattgtcaactgtgaaaag |
6395989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 146 - 198
Target Start/End: Original strand, 13322947 - 13322997
Alignment:
| Q |
146 |
ggagcatgaaatcattgtcaattgtgaaaagtctttgagatgaatgggaaaaa |
198 |
Q |
| |
|
|||||||| |||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
13322947 |
ggagcatggaatcattgtcaactgc--aaagtctttgagatgaatgggaaaaa |
13322997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University