View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_low_24 (Length: 366)
Name: NF2747_low_24
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 19 - 355
Target Start/End: Original strand, 33683569 - 33683905
Alignment:
| Q |
19 |
catataccaactaccaatataactgctgctagccatagtatagaggttcttagagctgcatcatttgccatggttgtgattagattgatatgtcaacaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33683569 |
catataccaactaccaatataactgctgctagccatagtatagaggttcttagagctgcatcatttgccatggttgtgattagattgatatgtcaccaac |
33683668 |
T |
 |
| Q |
119 |
caatattatagactttaggaaatagattcaatttaacttaattgttgattttggttacttgttatgagtggccatgctttacaattacggcagtggtaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33683669 |
caatattatagactttaggaaatagattcaatttaacttaattgttgattttggttacttgttatgagtggccatgctttacaattacggcagtggtaag |
33683768 |
T |
 |
| Q |
219 |
gcctagttaagacgtatgtatgagctttaaatgcaaactcaacggtcccttctataaactctttaattaatttaatgtgctacatcatagttgccgactt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33683769 |
gcctagttaagacgtatgtatgagctttaaatgcaaactcaacggtcccttctataaactctttaattaatttaatgtgctacatcatagttgccgactt |
33683868 |
T |
 |
| Q |
319 |
tgcatttgatttgccaagtgttatttccttccttctt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33683869 |
tgcatttgatttgccaagtgttatttccttccttctt |
33683905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University