View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_low_34 (Length: 306)
Name: NF2747_low_34
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 293
Target Start/End: Original strand, 1250358 - 1250628
Alignment:
| Q |
20 |
caactctctgttcaaccattcaattcattgattgagaagacagcacctagcaaccactacttttaatcaagctagcatagcatatattttgcttatctat |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1250358 |
caactctctgtgtaaccattcaattcattgattgaaaagacaacacctagcaaccactacttttaatcaagc----atagcatatattttgcttatctat |
1250453 |
T |
 |
| Q |
120 |
aaggaatcactccataaaagaaagttaatnnnnnnngttaatcnnnnnnn-gtttgttccaagccatgcaagaatatgattccctccctcccattaatct |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1250454 |
aaggaatcacttcataaaagaaagttaataaaaaaagttaattttttttttgtttgttccaagccatgcaagaatatgattccctccctcccattaatct |
1250553 |
T |
 |
| Q |
219 |
gcatcatcaccaattcaccatcactatttagtgctctagtccctccatccaaatcacttcctcacaaacaaaacc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1250554 |
gcatcatcaccaattcaccatcactatttagtgctctagtccctccatccaaatcacttcctcacaaacaaaacc |
1250628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 208 - 259
Target Start/End: Original strand, 8269309 - 8269359
Alignment:
| Q |
208 |
cccattaatctgcatcatcaccaattcaccatcactatttagtgctctagtc |
259 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
8269309 |
cccattcatctgcatcatcaccaattcaccatcactaatta-tgctctagtc |
8269359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University