View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_low_36 (Length: 291)
Name: NF2747_low_36
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 26600474 - 26600754
Alignment:
| Q |
1 |
tagtgatggagataaagtggaaaagttcacttgcttattggaatatgacaaaagatcatgtgagtttctttactttaatgcatgaagatgggattgaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26600474 |
tagtgatggagataaagtggaaaagttcacttgcttattggaatatgacaaaagatcatgtgagtttctttactttaatgcatgaagatgggattgaaat |
26600573 |
T |
|
| Q |
101 |
tgtattattgctatgtatttttgtcccttcagttattatgttttacatcagttggttactgttttcatcctttctcctcatgcttctttagtgtgctgtt |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26600574 |
tgtattattgctatgtatgtttgtcccttcagttattatgttt-acatcagttggttactgttttcatcctttctcctcatgcttctttagtgtgctgtt |
26600672 |
T |
|
| Q |
201 |
tgggtaaacatgtactgtgcatgcaggtttttggtttctgtgtactgatcatatggtataagaagcaaattcttttcctttg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26600673 |
tgggtaaacatgtactgtgcatgcaggtttttggtttctgtgtactgatcatatggtataagaagcaaattcttttcctttg |
26600754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University