View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_low_46 (Length: 269)
Name: NF2747_low_46
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 20 - 258
Target Start/End: Original strand, 46928988 - 46929226
Alignment:
| Q |
20 |
cacttcacgtcaaacgaaacgagtgtcttctttttcactttgtagctttccttttgttgtttattgtcaccaaccaaacacagtctctaatttcgaatcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46928988 |
cacttcacgtcaaacgaaacgagtgtcttctttttcactttgtagctttccttttgttgtttattgtcaccaaccaaacacagtctctaatttcgaatcc |
46929087 |
T |
 |
| Q |
120 |
ctagctatcatacattttctaatgcacgtctctactctaccttatagcatcgaactacgtgatgggaatgaattaaagactgttttgagtgacgacattt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46929088 |
ctagctatcatacattttctaatgcacgtctctactctaccttatagcatcgaactacgtgatgggaatgaattaaagactgttttgagtgacgacattt |
46929187 |
T |
 |
| Q |
220 |
cttccatccgttgcttctctcattcctagctccaccttt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46929188 |
cttccatccgttgcttctctcattcctagctccaccttt |
46929226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University