View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_low_49 (Length: 259)
Name: NF2747_low_49
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 4748930 - 4749161
Alignment:
| Q |
18 |
aaaggtaaccacgtctccaataaatggtcacgaattgtacaattatattggtctcatagaagatattgtagtgaaaaatttagaagattcgtctaaaacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4748930 |
aaaggtaaccacgtctccaataaatggtcacgaattgtacaattatattggtctcatagaagatattgtagtgaaaaatttagaagattcgtctaaaacg |
4749029 |
T |
|
| Q |
118 |
aacacaccggttgagtttctcaaagagaccaaaaagttcacttttgatgtcatcacttctgttttcttttcctctgatcgtgaacatgctgaccttgctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749030 |
aacacaccggttgagtttctcaaagaggccaaaaagttcacttttgatgtcatcacttctgtcttcttttcctctgatcgtgaacatgctgaccttgctt |
4749129 |
T |
|
| Q |
218 |
tggttgagcatttgtacattgattttcttcga |
249 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
4749130 |
tggttgagcatttgtacattgatttgcttcga |
4749161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 60 - 242
Target Start/End: Original strand, 4756810 - 4756992
Alignment:
| Q |
60 |
ttatattggtctcatagaagatattgtagtgaaaaatttagaagattcgtctaaaacgaacacaccggttgagtttctcaaagagaccaaaaagttcact |
159 |
Q |
| |
|
||||||| ||||||| || |||| || |||||| |||||||||| | |||||||| ||||||||| ||||||||| ||||||| | |||||| || |
|
|
| T |
4756810 |
ttatattagtctcattgaggatagtgctgtgaaacatttagaagagttgtctaaaatgaacacaccatgtgagtttcttaaagagatgagaaagtttgct |
4756909 |
T |
|
| Q |
160 |
tttgatgtcatcacttctgttttcttttcctctgatcgtgaacatgctgaccttgctttggttgagcatttgtacattgattt |
242 |
Q |
| |
|
||||| ||||||||| | | ||| |||| ||||||||||| || | ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
4756910 |
tttgaagtcatcactaccatcttcatttcttctgatcgtgatcacgtggaccttggtttggttgaaaatttgtacattgattt |
4756992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University