View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2747_low_56 (Length: 253)
Name: NF2747_low_56
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2747_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 38944501 - 38944266
Alignment:
| Q |
1 |
tatgcaagataacaatgaattatatattcatatatggtccccatcaccgccgatttcagctagctctgaacactcctctcttatagttttgtttggttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38944501 |
tatgcaagataacaatgaattatatattcatatatggtccccatcaccaccgatttcagctagctctgaacactcctctcttatagttttgtttggttat |
38944402 |
T |
|
| Q |
101 |
ggatataatgttgaattgaagccacctgcagtaatgagacattgtgattttgtgaggtgtaatgcacatggctttcatagccatgcacgatgaagaatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38944401 |
ggatataatgttgaattgaagccacctgcagtaatgagacattgtgactttgtgaggtgtaatgcacatggctttcatagccatgcacgatgaagaatgt |
38944302 |
T |
|
| Q |
201 |
ctaatgctcagtagcacatatatattctctgatatg |
236 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38944301 |
ctaatgctcagtaacacatatatattctctgatatg |
38944266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 38951823 - 38951777
Alignment:
| Q |
165 |
cacatggctttcatagccatgcacgatgaagaatgtctaatgctcag |
211 |
Q |
| |
|
|||| ||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
38951823 |
cacaaggcttccatagccatgcaagctgaagaatgtctaatgctcag |
38951777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University