View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2747_low_64 (Length: 236)

Name: NF2747_low_64
Description: NF2747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2747_low_64
NF2747_low_64
[»] chr5 (1 HSPs)
chr5 (1-221)||(22789354-22789577)
[»] chr3 (2 HSPs)
chr3 (10-218)||(54564822-54565033)
chr3 (19-161)||(12529905-12530047)
[»] scaffold0381 (1 HSPs)
scaffold0381 (85-161)||(6662-6738)
[»] chr4 (1 HSPs)
chr4 (85-161)||(27013045-27013121)


Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 22789577 - 22789354
Alignment:
1 actacgcttgagaatttggcagccccgtcttcggaccattatcccatccttttaaatagttgtcctgtgcaacggccttatttgcataaacgcagctttc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
22789577 actacgcttgagaatttggcagccccgtcttcggaccattatcccatccttttaaatagttgtcctgtgcaacggccttatttgcacaaacgcagctttc 22789478  T
101 attatgagaatgcttggtacccggaaccaggtttcaaggagttcgtgactgatgcttggcatatgcattcac---attcaattgtctctaaattatcttc 197  Q
     ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||    
22789477 gttatgagaatgcttggtacccggaaccaggtttcaagaagttcgtgactgatgcttggcatatgcattcactagattcaattgtctctaaattatcttc 22789378  T
198 ttgtgcggctgacatggtggtatg 221  Q
    ||||||||||||||||||||||||    
22789377 ttgtgcggctgacatggtggtatg 22789354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 10 - 218
Target Start/End: Complemental strand, 54565033 - 54564822
Alignment:
10 gagaatttggcagccccgtcttcggaccattatcccatccttttaaatagttgtcctgtgcaacggccttatttgcataaacgcagctttcattatgaga 109  Q
    ||||||||||||||||||||||||||||| ||||||||  | |||||||| ||||||||||| |||||| || |||||||||  ||||||| ||||||||    
54565033 gagaatttggcagccccgtcttcggaccactatcccattttgttaaatagatgtcctgtgcatcggcctcatatgcataaacatagctttcgttatgaga 54564934  T
110 atgcttggtacccggaaccaggtttcaaggagttcgtgactgatgcttggcatatgcatt---cacattcaattgtctctaaattatcttcttgtgcggc 206  Q
    |||||||||||||| ||| ||| ||||| ||| | ||||||||||| |||||||||||||   || || || ||||  ||||||||||||||||||||||    
54564933 atgcttggtacccgtaactaggcttcaaagagcttgtgactgatgcctggcatatgcattcaacaaatacagttgtacctaaattatcttcttgtgcggc 54564834  T
207 tgacatggtggt 218  Q
     |||||||||||    
54564833 agacatggtggt 54564822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 12530047 - 12529905
Alignment:
19 gcagccccgtcttcggaccattatcccatccttttaaatagttgtcctgtgcaacggccttatttgcataaacgcagctttcattatgagaatgcttggt 118  Q
    ||||| |||||||| || ||||||||||| ||||| |||||  | ||  | || || ||| || | |||||||| || |||| ||| |||||||  ||||    
12530047 gcagctccgtcttccgatcattatcccattcttttgaatagaagcccgttacagcgccctcatctccataaacgtagttttctttacgagaatgtgtggt 12529948  T
119 acccggaaccaggtttcaaggagttcgtgactgatgcttggca 161  Q
    |  |||||||||||||||||||  | |||||| ||||||||||    
12529947 attcggaaccaggtttcaaggaactagtgactaatgcttggca 12529905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0381 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0381
Description:

Target: scaffold0381; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 161
Target Start/End: Original strand, 6662 - 6738
Alignment:
85 cataaacgcagctttcattatgagaatgcttggtacccggaaccaggtttcaaggagttcgtgactgatgcttggca 161  Q
    |||||||| || |||| ||| |||||||| |||||  |||||||||||||||||||  | |||||| ||||||||||    
6662 cataaacgtagttttcgttacgagaatgcgtggtattcggaaccaggtttcaaggaactagtgactaatgcttggca 6738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 161
Target Start/End: Complemental strand, 27013121 - 27013045
Alignment:
85 cataaacgcagctttcattatgagaatgcttggtacccggaaccaggtttcaaggagttcgtgactgatgcttggca 161  Q
    |||||||| || |||| ||| |||||||| |||||  |||||||||||||||||||  | |||||| ||||||||||    
27013121 cataaacgtagttttcgttacgagaatgcgtggtattcggaaccaggtttcaaggaactagtgactaatgcttggca 27013045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University