View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_high_26 (Length: 465)
Name: NF2748_high_26
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 3e-64; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 50 - 174
Target Start/End: Complemental strand, 2551280 - 2551156
Alignment:
| Q |
50 |
gacatagtgagtgaagaaataccatgaaattttggcaggaccatgctgaggcatgtaactaaaaacaccttccacagcatccttaagctccgcaatagtg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551280 |
gacatagtgagtgaagaaataccatgaaattttggcaggaccatgctgaggcatgtaactaaaaacaccttccacagcatccttaagctccgcaatagtg |
2551181 |
T |
 |
| Q |
150 |
gcattcttcgaaacatgaacatctg |
174 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2551180 |
gcattcttcgaaacatgaacatctg |
2551156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 260 - 340
Target Start/End: Complemental strand, 2549920 - 2549840
Alignment:
| Q |
260 |
aaagaagttccgtctaatttgagaacagaaagccttaacggttccgaaggaagcttatcgtagagcaaactcttggtagaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2549920 |
aaagaagttccgtctaatttgagaacagaaagccttaacggttccgaaggaagcttatcgtagagcaaactcttggtagaa |
2549840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 376 - 448
Target Start/End: Complemental strand, 2549807 - 2549735
Alignment:
| Q |
376 |
tgatgaaaatagcgtagttttcttcttcatgttcggaattatcaacgataaacttgtttccgccatagaagct |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
2549807 |
tgatgaaaatagcgtagttttcttcttcatgttcggaagtatcaacgataaactagtttccgccatagaagct |
2549735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University