View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_high_39 (Length: 392)
Name: NF2748_high_39
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_high_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 4e-57; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 47 - 179
Target Start/End: Complemental strand, 11611660 - 11611528
Alignment:
| Q |
47 |
caataaacaactctgattgagtctagcagaagaggttagtcataaacctctatacgaattcatgctttcggaggtgcctatagttagtgaagattcctct |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11611660 |
caataaacaactctgattgagtctagcagaagaggttagtcagaaacctctatacgaattcatgctttcggaggtgcctatagttagtgatgattcctct |
11611561 |
T |
|
| Q |
147 |
aacatagatttttctgccagatcagggttctat |
179 |
Q |
| |
|
||||||||||||||| |||||| ||||||||| |
|
|
| T |
11611560 |
aacatagatttttcttgcagatctgggttctat |
11611528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 258 - 383
Target Start/End: Complemental strand, 11610909 - 11610784
Alignment:
| Q |
258 |
taaaaataaattattaaatttgaatatttgaattactacttgacagatcctatatagctctgcataagctcaaggaggattgaatatcgatctctatcat |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| |
|
|
| T |
11610909 |
taaaaataaattattaaatttgaatatttgaagtactacttgacagatcctatatagctctgcataagctcaaggaggattaaatattgatctggatcat |
11610810 |
T |
|
| Q |
358 |
cgagatatcatattgaagatctctct |
383 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
11610809 |
ggaaatatcatattgaagatctctct |
11610784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 207 - 263
Target Start/End: Complemental strand, 11611213 - 11611157
Alignment:
| Q |
207 |
tatacagtaatatcaaacaaagttcagaaccacatttaatgtctatttttctaaaaa |
263 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
11611213 |
tatacagtaatatcaaacaaacttcagaaccatatttaatgtctatttttttaaaaa |
11611157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University