View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_high_47 (Length: 372)
Name: NF2748_high_47
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 283 - 361
Target Start/End: Complemental strand, 14189679 - 14189601
Alignment:
| Q |
283 |
tccaaacggaggaaggagagcaatgattttctttgttggtggagacttgtttatcatgctacttgcttgctaaattctt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14189679 |
tccaaacggaggaaggagagcaatgattttctttgttggtggagacttgtttatcctgctacttgcttgctaaattctt |
14189601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University