View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_high_71 (Length: 277)
Name: NF2748_high_71
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_high_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 5743699 - 5743947
Alignment:
| Q |
18 |
aacttggacccaagactttaaaaaagttgcccgaaaagatgattttcttcccagccatgaaagtttttaatgtcttcacaactgcatcacaacatcgatc |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5743699 |
aacttggacccaaggctttaaaaaagttgtccgaaaagatgattttcttcccagccatgaaagtttttaatgtcttcacaactgcatcacaacatggatc |
5743798 |
T |
 |
| Q |
118 |
atgatttcatcaccattgaaacgtgatttcctgctatatcgaaaattgcaatgcgcacgcaatccaattgtaaaacctcgactaataattctttttacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5743799 |
atgatttcatcaccattgaaacgtgatttcctgctatatcgaaaattgcaatgggcacacaatccaattgtaaaacctcgactaatgattctttttacaa |
5743898 |
T |
 |
| Q |
218 |
taaacagactttgcggaagccttccacatcttcacgcaccctatgctac |
266 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
5743899 |
taaacagactttgcggaagccttccatatcttcacgcacccaatgctac |
5743947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University