View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_high_73 (Length: 273)
Name: NF2748_high_73
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_high_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 252
Target Start/End: Original strand, 45453044 - 45453278
Alignment:
| Q |
17 |
aatattgacggtgagattgaaaattgaggagtgaaggaggggttgtggcggaaagaggcgatgtgagacggcgtcacgatggtgccgttaaaggtgaagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45453044 |
aatattgacggtgagattgaaaattgaggagtgaaggaggggttgtggcggaaagaggcgatgtgagacggcgtcacgatggtgccgttaaaggtgaagg |
45453143 |
T |
 |
| Q |
117 |
agttaaggtcaattttatgctagcgacggcctaatccacaccaaggaggagnnnnnnntgagagtgtgagagagacggcaaggatgagattcgcgcaaga |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45453144 |
agttaaggtcaattttatgctagtgacggcctaatccacaccaaggaggag-aaaaaatgagagtgtgagagagacggcaaggatgagattcgcgcaaga |
45453242 |
T |
 |
| Q |
217 |
gagggtgaagcccacggtgatgaggcggagggggcg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45453243 |
gagggtgaagcccacggtgatgaggcggagggggcg |
45453278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University