View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_high_89 (Length: 248)
Name: NF2748_high_89
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_high_89 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 175 - 231
Target Start/End: Original strand, 35639558 - 35639614
Alignment:
| Q |
175 |
aaataaaataactcattgtattgctaaactctctttatgtgatcatagcccccatat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35639558 |
aaataaaataactcattgtattgctaaattctctttatgtgatcatagcccccatat |
35639614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 86
Target Start/End: Complemental strand, 35601531 - 35601498
Alignment:
| Q |
53 |
gattgtaaatttatagctaatactcttgccttat |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35601531 |
gattgtaaatttatagctaatactcttgccttat |
35601498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 35601606 - 35601553
Alignment:
| Q |
18 |
atatggaacggaatgcatgctgttt-gttcgaaaccgattgtaaatttatagct |
70 |
Q |
| |
|
||||||||| |||| |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35601606 |
atatggaacagaatacatgctgttttgttcgaaaacgattgtaaatttatagct |
35601553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 35639408 - 35639461
Alignment:
| Q |
18 |
atatggaacggaatgcatgctgttt-gttcgaaaccgattgtaaatttatagct |
70 |
Q |
| |
|
||||||||| |||| |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35639408 |
atatggaacagaatacatgctgttttgttcgaaaacgattgtaaatttatagct |
35639461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 86
Target Start/End: Original strand, 35639481 - 35639514
Alignment:
| Q |
53 |
gattgtaaatttatagctaatactcttgccttat |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35639481 |
gattgtaaatttatagctaatactcttgccttat |
35639514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University